SSSCA1 cDNA ORF Clone, Human, C-HA tag

Cat: HG10521-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SSSCA1 Reagents
CRO Services
Product recommended

All SSSCA1 Reagents
SSSCA1 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
600 bp
Description
Full length Clone DNA of Human Sjogren syndrome/scleroderma autoantigen 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SSSCA1 cDNA ORF Clone, Human, C-HA tag Alternative Names
p27 cDNA ORF Clone, Human
SSSCA1 Background Information
Full Name
Sjogren syndrome/scleroderma autoantigen 1

SSSCA1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SSSCA1 cDNA ORF Clone in Cloning Vector, Mouse MG50782-G
SSSCA1 cDNA ORF Clone, Mouse, untagged MG50782-UT
SSSCA1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50782-ACG
SSSCA1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50782-ACGLN
SSSCA1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50782-ANG
SSSCA1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50782-ACR
SSSCA1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50782-ANR
SSSCA1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50782-CF
SSSCA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50782-NF
SSSCA1 cDNA ORF Clone, Mouse, C-His tag MG50782-CH
SSSCA1 cDNA ORF Clone, Mouse, N-His tag MG50782-NH
SSSCA1 cDNA ORF Clone, Mouse, C-HA tag MG50782-CY
SSSCA1 cDNA ORF Clone, Mouse, N-HA tag MG50782-NY
SSSCA1 cDNA ORF Clone, Mouse, C-Myc tag MG50782-CM
SSSCA1 cDNA ORF Clone, Mouse, N-Myc tag MG50782-NM
SSSCA1 qPCR Primer Pairs, Mouse MP200756

SSSCA1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SSSCA1 cDNA ORF Clone in Cloning Vector, Human HG10521-M
SSSCA1 cDNA ORF Clone, Human, untagged HG10521-UT
SSSCA1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10521-ACG
SSSCA1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10521-ACGLN
SSSCA1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10521-ANG
SSSCA1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10521-ACR
SSSCA1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10521-ANR
SSSCA1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10521-CF
SSSCA1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10521-NF
SSSCA1 cDNA ORF Clone, Human, C-His tag HG10521-CH
SSSCA1 cDNA ORF Clone, Human, N-His tag HG10521-NH
SSSCA1 cDNA ORF Clone, Human, N-HA tag HG10521-NY
SSSCA1 cDNA ORF Clone, Human, C-Myc tag HG10521-CM
SSSCA1 cDNA ORF Clone, Human, N-Myc tag HG10521-NM
SSSCA1 qPCR Primer Pairs, Human HP100538
info info
添加购物车成功! 添加购物车失败!