SRSF1 cDNA ORF Clone, Human, C-HA tag

Cat: HG14651-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SRSF1 Reagents
CRO Services
Product recommended

All SRSF1 Reagents
SRSF1 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
747 bp
Description
Full length Clone DNA of Human serine/arginine-rich splicing factor 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SRSF1 cDNA ORF Clone, Human, C-HA tag Alternative Names
ASF cDNA ORF Clone, Human;SF2 cDNA ORF Clone, Human;SF2p33 cDNA ORF Clone, Human;SFRS1 cDNA ORF Clone, Human;SRp30a cDNA ORF Clone, Human
SRSF1 Background Information
Full Name
serine/arginine-rich splicing factor 1

SRSF1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SRSF1 cDNA ORF Clone in Cloning Vector, Rat RG88534-U
SRSF1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG88534-ACGLN

SRSF1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SRSF1 cDNA ORF Clone in Cloning Vector, Mouse MG59037-U
SRSF1 cDNA ORF Clone, Mouse, untagged MG59037-UT
SRSF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59037-ACGLN
SRSF1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59037-ACG
SRSF1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59037-ANG
SRSF1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59037-ACR
SRSF1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59037-ANR
SRSF1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59037-CF
SRSF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59037-NF
SRSF1 cDNA ORF Clone, Mouse, C-His tag MG59037-CH
SRSF1 cDNA ORF Clone, Mouse, N-His tag MG59037-NH
SRSF1 cDNA ORF Clone, Mouse, C-HA tag MG59037-CY
SRSF1 cDNA ORF Clone, Mouse, N-HA tag MG59037-NY
SRSF1 cDNA ORF Clone, Mouse, C-Myc tag MG59037-CM
SRSF1 cDNA ORF Clone, Mouse, N-Myc tag MG59037-NM

SRSF1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SRSF1 cDNA ORF Clone in Cloning Vector, Human HG14651-G
SRSF1 cDNA ORF Clone, Human, untagged HG14651-UT
SRSF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14651-ACG
SRSF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14651-ACGLN
SRSF1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14651-ANG
SRSF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14651-ACR
SRSF1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14651-ANR
SRSF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14651-CF
SRSF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14651-NF
SRSF1 cDNA ORF Clone, Human, C-His tag HG14651-CH
SRSF1 cDNA ORF Clone, Human, N-His tag HG14651-NH
SRSF1 cDNA ORF Clone, Human, N-HA tag HG14651-NY
SRSF1 cDNA ORF Clone, Human, C-Myc tag HG14651-CM
SRSF1 cDNA ORF Clone, Human, N-Myc tag HG14651-NM
SRSF1 qPCR Primer Pairs, Human HP103285
info info
添加购物车成功! 添加购物车失败!