SRPX2 cDNA ORF Clone, Human, N-His tag

Cat: HG13810-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SRPX2 Reagents
CRO Services
Product recommended

All SRPX2 Reagents
SRPX2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1398 bp
Description
Full length Clone DNA of Human sushi-repeat-containing protein, X-linked 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SRPX2 cDNA ORF Clone, Human, N-His tag Alternative Names
BPP cDNA ORF Clone, Human;CBPS cDNA ORF Clone, Human;PMGX cDNA ORF Clone, Human;RESDX cDNA ORF Clone, Human;SRPUL cDNA ORF Clone, Human
SRPX2 Background Information
Full Name
sushi-repeat containing protein, X-linked 2

SRPX2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SRPX2 cDNA ORF Clone in Cloning Vector, Mouse MG53613-U
SRPX2 cDNA ORF Clone, Mouse, untagged MG53613-UT
SRPX2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53613-ACGLN
SRPX2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53613-ACG
SRPX2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53613-ACR
SRPX2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53613-CF
SRPX2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53613-NF
SRPX2 cDNA ORF Clone, Mouse, C-His tag MG53613-CH
SRPX2 cDNA ORF Clone, Mouse, N-His tag MG53613-NH
SRPX2 cDNA ORF Clone, Mouse, C-HA tag MG53613-CY
SRPX2 cDNA ORF Clone, Mouse, N-HA tag MG53613-NY
SRPX2 cDNA ORF Clone, Mouse, C-Myc tag MG53613-CM
SRPX2 cDNA ORF Clone, Mouse, N-Myc tag MG53613-NM

SRPX2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SRPX2 cDNA ORF Clone in Cloning Vector, Human HG13810-G
SRPX2 cDNA ORF Clone, Human, untagged HG13810-UT
SRPX2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13810-ACGLN
SRPX2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13810-ACG
SRPX2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13810-ACR
SRPX2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13810-G-F
SRPX2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13810-CF
SRPX2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13810-NF
SRPX2 cDNA ORF Clone, Human, C-His tag HG13810-CH
SRPX2 cDNA ORF Clone, Human, C-HA tag HG13810-CY
SRPX2 cDNA ORF Clone, Human, N-HA tag HG13810-NY
SRPX2 cDNA ORF Clone, Human, C-Myc tag HG13810-CM
SRPX2 cDNA ORF Clone, Human, N-Myc tag HG13810-NM
SRPX2 qPCR Primer Pairs, Human HP102483
info info
添加购物车成功! 添加购物车失败!