SRPRB cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG15248-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SRPRB Reagents
CRO Services
Product recommended

All SRPRB Reagents
SRPRB cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
816 bp
Description
Full length Clone DNA of Human signal recognition particle receptor, B subunit with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SRPRB cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
APMCF1 cDNA ORF Clone, Human
SRPRB Background Information
Full Name
signal recognition particle receptor, B subunit

SRPRB cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SRPRB cDNA ORF Clone in Cloning Vector, Rat RG81450-G

SRPRB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SRPRB cDNA ORF Clone in Cloning Vector, Mouse MG52154-G
SRPRB cDNA ORF Clone, Mouse, untagged MG52154-UT
SRPRB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52154-ACGLN
SRPRB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52154-ACG
SRPRB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52154-ACR
SRPRB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52154-CF
SRPRB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52154-NF
SRPRB cDNA ORF Clone, Mouse, C-His tag MG52154-CH
SRPRB cDNA ORF Clone, Mouse, N-His tag MG52154-NH
SRPRB cDNA ORF Clone, Mouse, C-HA tag MG52154-CY
SRPRB cDNA ORF Clone, Mouse, N-HA tag MG52154-NY
SRPRB cDNA ORF Clone, Mouse, C-Myc tag MG52154-CM
SRPRB cDNA ORF Clone, Mouse, N-Myc tag MG52154-NM
SRPRB qPCR Primer Pairs, Mouse MP202027

SRPRB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SRPRB cDNA ORF Clone in Cloning Vector, Human HG15248-G
SRPRB cDNA ORF Clone, Human, untagged HG15248-UT
SRPRB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15248-ACGLN
SRPRB cDNA ORF Clone, Human, C-GFPSpark® tag HG15248-ACG
SRPRB cDNA ORF Clone, Human, C-OFPSpark® tag HG15248-ACR
SRPRB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15248-CF
SRPRB cDNA ORF Clone, Human, C-His tag HG15248-CH
SRPRB cDNA ORF Clone, Human, N-His tag HG15248-NH
SRPRB cDNA ORF Clone, Human, C-HA tag HG15248-CY
SRPRB cDNA ORF Clone, Human, N-HA tag HG15248-NY
SRPRB cDNA ORF Clone, Human, C-Myc tag HG15248-CM
SRPRB cDNA ORF Clone, Human, N-Myc tag HG15248-NM
SRPRB qPCR Primer Pairs, Human HP103874
info info
添加购物车成功! 添加购物车失败!