Quick Order

Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human SRPK3 cDNA Clone Product Information
NCBI RefSeq:NM_001170760.1
RefSeq ORF Size:1701bp
cDNA Description:Full length Clone DNA of Homo sapiens SRSF protein kinase 3 transcript variant 2.
Gene Synonym:MSSK1, STK23, MSSK-1, MGC102944, SRPK3
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid on other vectors
Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG12132-ACG$245
Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG12132-ACR$245
Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG12132-ANG$245
Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG12132-ANR$245
Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tagHG12132-CF$215
Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His tagHG12132-CH$215
Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc tagHG12132-CM$215
Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA tagHG12132-CY$215
Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone in cloning vectorHG12132-G$75
Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag tagHG12132-NF$215
Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His tagHG12132-NH$215
Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Myc tagHG12132-NM$215
Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA tagHG12132-NY$215
Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmidHG12132-UT$215
 Learn more about expression Vectors
Product nameProduct name
Background

Serine / threonine-protein kinase SRPK3, also known as Muscle-specific serine kinase 1, Serine/arginine-rich protein-specific kinase 3, SR-protein-specific kinase 3, Serine / threonine-protein kinase 23, MSSK-1, SRPK3 and MSSK1, is a member of the protein kinase superfamily and CMGC Ser / Thr protein kinase family. SRPK3 is a protein kinase belonging to serine/arginine protein kinases (SRPK) family, which phosphorylates serine / arginine repeat-containing proteins, and is controlled by a muscle-specific enhancer directly regulated by MEF2. SRPK3 / MSSK1 contains one protein kinase domain. SRPK3 / MSSK1 is exclusively expressed in skeletal and heart muscle. It is required for normal muscle development. Myocyte enhancer factor 2 (MEF2) plays essential roles in transcriptional control of muscle development. Normal muscle growth and homeostasis require MEF2-dependent signaling by SRPK3.

References
  • Greenman C., et al., 2007, Nature 446:153-8.
  • Xu,Y. et al., 2011, Mol Biol Rep. 38 (5):2903-9.
  • Size / Price
    Catalog: HG12132-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"