Quick Order

Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Human SRPK3 cDNA Clone Product Information
    NCBI RefSeq:NM_001170760.1
    RefSeq ORF Size:1701bp
    cDNA Description:Full length Clone DNA of Homo sapiens SRSF protein kinase 3 transcript variant 2 with N terminal HA tag.
    Gene Synonym:MSSK1, STK23, MSSK-1, MGC102944, SRPK3
    Species:Human
    Vector:pCMV3-N-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SRPK3 qPCR primers for gene expression analysis, HP101658 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA tag on other vectors
    Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG12132-ACG$245
    Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG12132-ACR$245
    Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG12132-ANG$245
    Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG12132-ANR$245
    Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tagHG12132-CF$215
    Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His tagHG12132-CH$215
    Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc tagHG12132-CM$215
    Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA tagHG12132-CY$215
    Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone in cloning vectorHG12132-G$75
    Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag tagHG12132-NF$215
    Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His tagHG12132-NH$215
    Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Myc tagHG12132-NM$215
    Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA tagHG12132-NY$215
    Human STK23/MSSK1/SRPK3 transcript variant 2 Gene ORF cDNA clone expression plasmidHG12132-UT$215
     Learn more about expression Vectors
    Product nameProduct name
    Background

    Serine / threonine-protein kinase SRPK3, also known as Muscle-specific serine kinase 1, Serine/arginine-rich protein-specific kinase 3, SR-protein-specific kinase 3, Serine / threonine-protein kinase 23, MSSK-1, SRPK3 and MSSK1, is a member of the protein kinase superfamily and CMGC Ser / Thr protein kinase family. SRPK3 is a protein kinase belonging to serine/arginine protein kinases (SRPK) family, which phosphorylates serine / arginine repeat-containing proteins, and is controlled by a muscle-specific enhancer directly regulated by MEF2. SRPK3 / MSSK1 contains one protein kinase domain. SRPK3 / MSSK1 is exclusively expressed in skeletal and heart muscle. It is required for normal muscle development. Myocyte enhancer factor 2 (MEF2) plays essential roles in transcriptional control of muscle development. Normal muscle growth and homeostasis require MEF2-dependent signaling by SRPK3.

    References
  • Greenman C., et al., 2007, Nature 446:153-8.
  • Xu,Y. et al., 2011, Mol Biol Rep. 38 (5):2903-9.
  • Size / Price
    Catalog: HG12132-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"