SPRYD4 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG16379-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SPRYD4 Reagents
CRO Services
Product recommended

All SPRYD4 Reagents
SPRYD4 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
624 bp
Description
Full length Clone DNA of Human SPRY domain containing 4 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SPRYD4 Background Information
Full Name
SPRY domain containing 4

SPRYD4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SPRYD4 cDNA ORF Clone in Cloning Vector, Rat RG80846-U
SPRYD4 cDNA ORF Clone, Rat, untagged RG80846-UT
SPRYD4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80846-ACGLN
SPRYD4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80846-ACG
SPRYD4 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80846-ANG
SPRYD4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80846-ACR
SPRYD4 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80846-ANR
SPRYD4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80846-CF
SPRYD4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80846-NF
SPRYD4 cDNA ORF Clone, Rat, C-His tag RG80846-CH
SPRYD4 cDNA ORF Clone, Rat, N-His tag RG80846-NH
SPRYD4 cDNA ORF Clone, Rat, C-HA tag RG80846-CY
SPRYD4 cDNA ORF Clone, Rat, N-HA tag RG80846-NY
SPRYD4 cDNA ORF Clone, Rat, C-Myc tag RG80846-CM
SPRYD4 cDNA ORF Clone, Rat, N-Myc tag RG80846-NM
SPRYD4 qPCR Primer Pairs, Rat RP300810

SPRYD4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SPRYD4 cDNA ORF Clone in Cloning Vector, Human HG16379-G
SPRYD4 cDNA ORF Clone, Human, untagged HG16379-UT
SPRYD4 cDNA ORF Clone, Human, C-GFPSpark® tag HG16379-ACG
SPRYD4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16379-ACGLN
SPRYD4 cDNA ORF Clone, Human, N-GFPSpark® tag HG16379-ANG
SPRYD4 cDNA ORF Clone, Human, C-OFPSpark® tag HG16379-ACR
SPRYD4 cDNA ORF Clone, Human, N-OFPSpark® tag HG16379-ANR
SPRYD4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16379-CF
SPRYD4 cDNA ORF Clone, Human, C-His tag HG16379-CH
SPRYD4 cDNA ORF Clone, Human, N-His tag HG16379-NH
SPRYD4 cDNA ORF Clone, Human, C-HA tag HG16379-CY
SPRYD4 cDNA ORF Clone, Human, N-HA tag HG16379-NY
SPRYD4 cDNA ORF Clone, Human, C-Myc tag HG16379-CM
SPRYD4 cDNA ORF Clone, Human, N-Myc tag HG16379-NM
SPRYD4 qPCR Primer Pairs, Human HP105129
info info
添加购物车成功! 添加购物车失败!