SPRY1 cDNA ORF Clone, Human, N-His tag

Cat: HG13035-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SPRY1 Reagents
CRO Services
Product recommended

All SPRY1 Reagents
SPRY1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
960 bp
Description
Full length Clone DNA of Human sprouty homolog 1, antagonist of FGF signaling (Drosophila) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SPRY1 cDNA ORF Clone, Human, N-His tag Alternative Names
hSPRY1 cDNA ORF Clone, Human
SPRY1 Background Information
Full Name
sprouty homolog 1, antagonist of FGF signaling (Drosophila)

SPRY1 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
SPRY1 cDNA ORF Clone in Cloning Vector, Canine DG70163-U

SPRY1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SPRY1 cDNA ORF Clone in Cloning Vector, Rat RG88458-U
SPRY1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG88458-ACGLN

SPRY1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SPRY1 cDNA ORF Clone in Cloning Vector, Mouse MG57688-U
SPRY1 cDNA ORF Clone, Mouse, untagged MG57688-UT
SPRY1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57688-ACGLN
SPRY1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57688-ACG
SPRY1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57688-ANG
SPRY1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57688-ACR
SPRY1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57688-ANR
SPRY1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57688-CF
SPRY1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57688-NF
SPRY1 cDNA ORF Clone, Mouse, C-His tag MG57688-CH
SPRY1 cDNA ORF Clone, Mouse, N-His tag MG57688-NH
SPRY1 cDNA ORF Clone, Mouse, C-HA tag MG57688-CY
SPRY1 cDNA ORF Clone, Mouse, N-HA tag MG57688-NY
SPRY1 cDNA ORF Clone, Mouse, C-Myc tag MG57688-CM
SPRY1 cDNA ORF Clone, Mouse, N-Myc tag MG57688-NM

SPRY1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SPRY1 cDNA ORF Clone in Cloning Vector, Human HG13035-G
SPRY1 cDNA ORF Clone, Human, untagged HG13035-UT
SPRY1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13035-ACGLN
SPRY1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13035-ACG
SPRY1 cDNA ORF Clone, Human, N-GFPSpark® tag HG13035-ANG
SPRY1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13035-ACR
SPRY1 cDNA ORF Clone, Human, N-OFPSpark® tag HG13035-ANR
SPRY1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13035-CF
SPRY1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13035-NF
SPRY1 cDNA ORF Clone, Human, C-His tag HG13035-CH
SPRY1 cDNA ORF Clone, Human, C-HA tag HG13035-CY
SPRY1 cDNA ORF Clone, Human, C-HA tag HG13035-G-Y
SPRY1 cDNA ORF Clone, Human, N-HA tag HG13035-NY
SPRY1 cDNA ORF Clone, Human, C-Myc tag HG13035-CM
SPRY1 cDNA ORF Clone, Human, N-Myc tag HG13035-NM
SPRY1 qPCR Primer Pairs, Human HP101673
info info
添加购物车成功! 添加购物车失败!