SPINK4 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11669-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SPINK4 Reagents
CRO Services
Product recommended

All SPINK4 Reagents
SPINK4 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
261 bp
Description
Full length Clone DNA of Human serine peptidase inhibitor, Kazal type 4 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SPINK4 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
HEL136 cDNA ORF Clone, Human;MGC133107 cDNA ORF Clone, Human;PEC-60 cDNA ORF Clone, Human;PEC60 cDNA ORF Clone, Human;SPINK4 cDNA ORF Clone, Human
SPINK4 Background Information

Serine protease inhibitor Kazal-type 4, also known as Peptide PEC-60 homolog and SPINK4, is a secreted protein which contains one Kazal-like domain. SPINK4 is a member of the SPINK protein family. The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). SPINK1 plays an important role in protecting the pancreas against excessive trypsinogen activation. It is a potent natural inhibitor of pancreatic trypsin activity. SPINK1 mutations are associated with the development of acute and chronic pancreatitis and have been detected in all forms of chronic pancreatitis. SPINK2 functions as a trypsin/acrosin inhibitor and is synthesized mainly in the testis and seminal vesicle where its activity is engaged in fertility. The SPINK2 protein contains a typical Kazal domain composed by six cysteine residues forming three disulfide bridges. SPINK9 was identified in human skin. Its expression was strong in palmar epidermis, but not detectable or very low in non palmoplantar skin.

Full Name
serine peptidase inhibitor, Kazal type 4
References
  • Schneider, A. et al., 2004,Gastroenterol Clin North Am. 33 (4): 789-806.
  • Wapenaar, MC. et al., 2007, Immunogenetics. 59 (5): 349-57.
  • Brattsand, M. et al., 2009, J Invest Dermatol. 129 (7): 1656-65.
  • Chen, T. et al., 2009, Proteins. 77 (1): 209-19.
  • Noah, TK. et al., 2010, Exp Cell Res. 316 (3): 452-65.
  • SPINK4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SPINK4 cDNA ORF Clone in Cloning Vector, Mouse MG50953-G
    SPINK4 cDNA ORF Clone, Mouse, untagged MG50953-UT
    SPINK4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50953-ACGLN
    SPINK4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50953-ACG
    SPINK4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50953-ACR
    SPINK4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50953-CF
    SPINK4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50953-NF
    SPINK4 cDNA ORF Clone, Mouse, C-His tag MG50953-CH
    SPINK4 cDNA ORF Clone, Mouse, N-His tag MG50953-NH
    SPINK4 cDNA ORF Clone, Mouse, C-HA tag MG50953-CY
    SPINK4 cDNA ORF Clone, Mouse, N-HA tag MG50953-NY
    SPINK4 cDNA ORF Clone, Mouse, C-Myc tag MG50953-CM
    SPINK4 cDNA ORF Clone, Mouse, N-Myc tag MG50953-NM
    SPINK4 qPCR Primer Pairs, Mouse MP200922

    SPINK4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SPINK4 cDNA ORF Clone in Cloning Vector, Human HG11669-M
    SPINK4 cDNA ORF Clone, Human, untagged HG11669-UT
    SPINK4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11669-ACGLN
    SPINK4 cDNA ORF Clone, Human, C-GFPSpark® tag HG11669-ACG
    SPINK4 cDNA ORF Clone, Human, C-OFPSpark® tag HG11669-ACR
    SPINK4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11669-NF
    SPINK4 cDNA ORF Clone, Human, C-His tag HG11669-CH
    SPINK4 cDNA ORF Clone, Human, N-His tag HG11669-NH
    SPINK4 cDNA ORF Clone, Human, C-HA tag HG11669-CY
    SPINK4 cDNA ORF Clone, Human, N-HA tag HG11669-NY
    SPINK4 cDNA ORF Clone, Human, C-Myc tag HG11669-CM
    SPINK4 cDNA ORF Clone, Human, N-Myc tag HG11669-NM
    SPINK4 qPCR Primer Pairs, Human HP101512
    info info
    添加购物车成功! 添加购物车失败!