SPINK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG13357-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All SPINK1 Reagents

CRO Services

Product recommended


All SPINK1 Reagents

SPINK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
240 bp
Description
Full length Clone DNA of Human serine peptidase inhibitor, Kazal type 1 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SPINK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

PCTT cDNA ORF Clone, Human;PSTI cDNA ORF Clone, Human;Spink3 cDNA ORF Clone, Human;TATI cDNA ORF Clone, Human;TCP cDNA ORF Clone, Human

SPINK1 Background Information

Full Name
serine peptidase inhibitor, Kazal type 1

SPINK1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
SPINK1 cDNA ORF Clone in Cloning Vector, Rhesus CG90530-U
SPINK1 cDNA ORF Clone, Rhesus, untagged CG90530-UT
SPINK1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90530-ACGLN
SPINK1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90530-ACG
SPINK1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90530-ACR
SPINK1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90530-CF
SPINK1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90530-NF
SPINK1 cDNA ORF Clone, Rhesus, C-His tag CG90530-CH
SPINK1 cDNA ORF Clone, Rhesus, N-His tag CG90530-NH
SPINK1 cDNA ORF Clone, Rhesus, C-HA tag CG90530-CY
SPINK1 cDNA ORF Clone, Rhesus, N-HA tag CG90530-NY
SPINK1 cDNA ORF Clone, Rhesus, C-Myc tag CG90530-CM
SPINK1 cDNA ORF Clone, Rhesus, N-Myc tag CG90530-NM

SPINK1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SPINK1 cDNA ORF Clone in Cloning Vector, Human HG13357-G
SPINK1 cDNA ORF Clone, Human, untagged HG13357-UT
SPINK1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13357-ACG
SPINK1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13357-ACGLN
SPINK1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13357-ACR
SPINK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13357-CF
SPINK1 cDNA ORF Clone, Human, C-His tag HG13357-CH
SPINK1 cDNA ORF Clone, Human, N-His tag HG13357-NH
SPINK1 cDNA ORF Clone, Human, C-HA tag HG13357-CY
SPINK1 cDNA ORF Clone, Human, N-HA tag HG13357-NY
SPINK1 cDNA ORF Clone, Human, C-Myc tag HG13357-CM
SPINK1 cDNA ORF Clone, Human, N-Myc tag HG13357-NM
SPINK1 qPCR Primer Pairs, Human HP102061
info info
添加购物车成功! 添加购物车失败!