Quick Order

Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human ATL1 cDNA Clone Product Information
    NCBI RefSeq:NM_015915.4
    RefSeq ORF Size:1677bp
    cDNA Description:Full length Clone DNA of Homo sapiens atlastin GTPase 1 , transcript variant 1 with C terminal His tag.
    Gene Synonym:FSP1, GBP3, SPG3, SPG3A, AD-FSP, atlastin1
    Species:Human
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ATL1 qPCR primers for gene expression analysis, HP100540 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
    Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10523-ACG$245
    Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10523-ACR$245
    Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10523-ANG$245
    Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10523-ANR$245
    Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10523-CF$215
    Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG10523-CH$215
    Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10523-CM$215
    Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG10523-CY$215
    Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10523-M$75
    Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10523-M-F$215
    Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10523-NF$215
    Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG10523-NH$215
    Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10523-NM$215
    Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG10523-NY$215
    Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmidHG10523-UT$215
     Learn more about expression Vectors
    Product nameProduct name
    Background

    Atlastin-1, also known as Spastic paraplegia 3 protein A, Guanine nucleotide-binding protein 3, GTP-binding protein 3, GBP3, ATL1 and SPG3A, is a multi-pass membrane protein which belongs to the GBP family and atlastin subfamily. ATL1 / SPG3A is expressed predominantly in the adult and fetal central nervous system. Expression of ATL1 / SPG3A in adult brain is at least 50-fold higher than in other tissues. ATL1 / SPG3A is detected predominantly in pyramidal neurons in the cerebral cortex and the hippocampus of the brain. ATL1 / SPG3A is also expressed in upper and lower motor neurons (at protein level). A distinguishing feature of ATL1 / SPG3A is its frequent early onset, raising the possibility that developmental abnormalities may be involved in its pathogenesis. Missense SPG3A mutant atlastin-1 proteins have impaired GTPase activity and may act in a dominant-negative, loss-of-function manner by forming mixed oligomers with wild-type atlastin-1. Defects in ATL1 / SPG3A are the cause of spastic paraplegia autosomal dominant type 3 (SPG3), also known as Strumpell-Lorrain syndrome. Spastic paraplegia is a degenerative spinal cord disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs.

    Size / Price
    Catalog: HG10523-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"