After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human ATL1 cDNA Clone Product Information
NCBI RefSeq:NM_015915.4
RefSeq ORF Size:1677bp
cDNA Description:Full length Clone DNA of Homo sapiens atlastin GTPase 1 , transcript variant 1 with C terminal HA tag.
Gene Synonym:FSP1, GBP3, SPG3, SPG3A, AD-FSP, atlastin1
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tag on other vectors
Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10523-ACG$245
Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10523-ACR$245
Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10523-ANG$245
Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10523-ANR$245
Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10523-CF$215
Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG10523-CH$215
Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10523-CM$215
Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG10523-CY$215
Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10523-M$75
Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10523-M-F$215
Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10523-NF$215
Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG10523-NH$215
Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10523-NM$215
Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG10523-NY$215
Human SPG3A/ATL1 transcript variant 1 Gene ORF cDNA clone expression plasmidHG10523-UT$215
 Learn more about expression Vectors
Product nameProduct name
Background

Atlastin-1, also known as Spastic paraplegia 3 protein A, Guanine nucleotide-binding protein 3, GTP-binding protein 3, GBP3, ATL1 and SPG3A, is a multi-pass membrane protein which belongs to the GBP family and atlastin subfamily. ATL1 / SPG3A is expressed predominantly in the adult and fetal central nervous system. Expression of ATL1 / SPG3A in adult brain is at least 50-fold higher than in other tissues. ATL1 / SPG3A is detected predominantly in pyramidal neurons in the cerebral cortex and the hippocampus of the brain. ATL1 / SPG3A is also expressed in upper and lower motor neurons (at protein level). A distinguishing feature of ATL1 / SPG3A is its frequent early onset, raising the possibility that developmental abnormalities may be involved in its pathogenesis. Missense SPG3A mutant atlastin-1 proteins have impaired GTPase activity and may act in a dominant-negative, loss-of-function manner by forming mixed oligomers with wild-type atlastin-1. Defects in ATL1 / SPG3A are the cause of spastic paraplegia autosomal dominant type 3 (SPG3), also known as Strumpell-Lorrain syndrome. Spastic paraplegia is a degenerative spinal cord disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs.

Size / Price
Catalog: HG10523-CY
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"