SPCS3 cDNA ORF Clone, Human, N-Myc tag

Cat: HG16215-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SPCS3 Reagents
CRO Services
Product recommended

All SPCS3 Reagents
SPCS3 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
543 bp
Description
Full length Clone DNA of Human signal peptidase complex subunit 3 homolog (S. cerevisiae) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SPCS3 cDNA ORF Clone, Human, N-Myc tag Alternative Names
PRO3567 cDNA ORF Clone, Human;SPC22/23 cDNA ORF Clone, Human;SPC3 cDNA ORF Clone, Human;YLR066W cDNA ORF Clone, Human
SPCS3 Background Information
Full Name
signal peptidase complex subunit 3 homolog (S. cerevisiae)

SPCS3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SPCS3 cDNA ORF Clone in Cloning Vector, Mouse MG54649-U
SPCS3 cDNA ORF Clone, Mouse, untagged MG54649-UT
SPCS3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54649-ACG
SPCS3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54649-ACGLN
SPCS3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG54649-ANG
SPCS3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG54649-ACR
SPCS3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG54649-ANR
SPCS3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG54649-CF
SPCS3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG54649-NF
SPCS3 cDNA ORF Clone, Mouse, C-His tag MG54649-CH
SPCS3 cDNA ORF Clone, Mouse, N-His tag MG54649-NH
SPCS3 cDNA ORF Clone, Mouse, C-HA tag MG54649-CY
SPCS3 cDNA ORF Clone, Mouse, N-HA tag MG54649-NY
SPCS3 cDNA ORF Clone, Mouse, C-Myc tag MG54649-CM
SPCS3 cDNA ORF Clone, Mouse, N-Myc tag MG54649-NM

SPCS3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SPCS3 cDNA ORF Clone in Cloning Vector, Human HG16215-G
SPCS3 cDNA ORF Clone, Human, untagged HG16215-UT
SPCS3 cDNA ORF Clone, Human, C-GFPSpark® tag HG16215-ACG
SPCS3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16215-ACGLN
SPCS3 cDNA ORF Clone, Human, N-GFPSpark® tag HG16215-ANG
SPCS3 cDNA ORF Clone, Human, C-OFPSpark® tag HG16215-ACR
SPCS3 cDNA ORF Clone, Human, N-OFPSpark® tag HG16215-ANR
SPCS3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16215-CF
SPCS3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16215-NF
SPCS3 cDNA ORF Clone, Human, C-His tag HG16215-CH
SPCS3 cDNA ORF Clone, Human, N-His tag HG16215-NH
SPCS3 cDNA ORF Clone, Human, C-HA tag HG16215-CY
SPCS3 cDNA ORF Clone, Human, N-HA tag HG16215-NY
SPCS3 cDNA ORF Clone, Human, C-Myc tag HG16215-CM
SPCS3 qPCR Primer Pairs, Human HP104980
info info
添加购物车成功! 添加购物车失败!