SPCS2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG16395-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SPCS2 Reagents
CRO Services
Product recommended

All SPCS2 Reagents
SPCS2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
681 bp
Description
Full length Clone DNA of Human signal peptidase complex subunit 2 homolog (S. cerevisiae) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SPCS2 Background Information
Full Name
signal peptidase complex subunit 2 homolog (S. cerevisiae)

SPCS2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SPCS2 cDNA ORF Clone in Cloning Vector, Rat RG81055-U
SPCS2 cDNA ORF Clone, Rat, untagged RG81055-UT
SPCS2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81055-ACGLN
SPCS2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81055-ACG
SPCS2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81055-ACR
SPCS2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81055-CF
SPCS2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81055-NF
SPCS2 cDNA ORF Clone, Rat, C-His tag RG81055-CH
SPCS2 cDNA ORF Clone, Rat, N-His tag RG81055-NH
SPCS2 cDNA ORF Clone, Rat, C-HA tag RG81055-CY
SPCS2 cDNA ORF Clone, Rat, N-HA tag RG81055-NY
SPCS2 cDNA ORF Clone, Rat, C-Myc tag RG81055-CM
SPCS2 cDNA ORF Clone, Rat, N-Myc tag RG81055-NM
SPCS2 qPCR Primer Pairs, Rat RP301019

SPCS2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SPCS2 cDNA ORF Clone in Cloning Vector, Mouse MG52658-G
SPCS2 cDNA ORF Clone, Mouse, untagged MG52658-UT
SPCS2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52658-ACGLN
SPCS2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52658-ACG
SPCS2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52658-ANG
SPCS2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52658-ACR
SPCS2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52658-ANR
SPCS2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52658-CF
SPCS2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52658-NF
SPCS2 cDNA ORF Clone, Mouse, C-His tag MG52658-CH
SPCS2 cDNA ORF Clone, Mouse, N-His tag MG52658-NH
SPCS2 cDNA ORF Clone, Mouse, C-HA tag MG52658-CY
SPCS2 cDNA ORF Clone, Mouse, N-HA tag MG52658-NY
SPCS2 cDNA ORF Clone, Mouse, C-Myc tag MG52658-CM
SPCS2 cDNA ORF Clone, Mouse, N-Myc tag MG52658-NM
SPCS2 qPCR Primer Pairs, Mouse MP202529

SPCS2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SPCS2 cDNA ORF Clone in Cloning Vector, Human HG16395-G
SPCS2 cDNA ORF Clone, Human, untagged HG16395-UT
SPCS2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16395-ACG
SPCS2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16395-ACGLN
SPCS2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16395-ANG
SPCS2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16395-ACR
SPCS2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16395-ANR
SPCS2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16395-NF
SPCS2 cDNA ORF Clone, Human, C-His tag HG16395-CH
SPCS2 cDNA ORF Clone, Human, N-His tag HG16395-NH
SPCS2 cDNA ORF Clone, Human, C-HA tag HG16395-CY
SPCS2 cDNA ORF Clone, Human, N-HA tag HG16395-NY
SPCS2 cDNA ORF Clone, Human, C-Myc tag HG16395-CM
SPCS2 cDNA ORF Clone, Human, N-Myc tag HG16395-NM
SPCS2 qPCR Primer Pairs, Human HP105144
info info
添加购物车成功! 添加购物车失败!