SOSTDC1 cDNA ORF Clone, Human, C-His tag

Cat: HG12127-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SOSTDC1 Reagents
CRO Services
Product recommended

All SOSTDC1 Reagents
SOSTDC1 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
666 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human sclerostin domain containing 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Restriction Sites
KpnI + XbaI(6kb+0.67kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
SOSTDC1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SOSTDC1 cDNA ORF Clone, Human, C-His tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5610
SOSTDC1 cDNA ORF Clone, Human, C-His tag Alternative Names
CDA019 cDNA ORF Clone, Human;ECTODIN cDNA ORF Clone, Human;USAG1 cDNA ORF Clone, Human
SOSTDC1 Background Information
Full Name
sclerostin domain containing 1

SOSTDC1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SOSTDC1 cDNA ORF Clone in Cloning Vector, Mouse MG51603-U
SOSTDC1 cDNA ORF Clone, Mouse, untagged MG51603-UT
SOSTDC1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51603-ACGLN
SOSTDC1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51603-ACG
SOSTDC1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51603-ACR
SOSTDC1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51603-CF
SOSTDC1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51603-NF
SOSTDC1 cDNA ORF Clone, Mouse, C-His tag MG51603-CH
SOSTDC1 cDNA ORF Clone, Mouse, N-His tag MG51603-NH
SOSTDC1 cDNA ORF Clone, Mouse, C-HA tag MG51603-CY
SOSTDC1 cDNA ORF Clone, Mouse, N-HA tag MG51603-NY
SOSTDC1 cDNA ORF Clone, Mouse, C-Myc tag MG51603-CM
SOSTDC1 cDNA ORF Clone, Mouse, N-Myc tag MG51603-NM
SOSTDC1 qPCR Primer Pairs, Mouse MP201486

SOSTDC1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SOSTDC1 cDNA ORF Clone in Cloning Vector, Human HG12127-M
SOSTDC1 cDNA ORF Clone, Human, untagged HG12127-UT
SOSTDC1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12127-ACGLN
SOSTDC1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12127-ACG
SOSTDC1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12127-ACR
SOSTDC1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12127-CF
SOSTDC1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12127-NF
SOSTDC1 cDNA ORF Clone, Human, N-His tag HG12127-NH
SOSTDC1 cDNA ORF Clone, Human, C-HA tag HG12127-CY
SOSTDC1 cDNA ORF Clone, Human, N-HA tag HG12127-NY
SOSTDC1 cDNA ORF Clone, Human, C-Myc tag HG12127-CM
SOSTDC1 cDNA ORF Clone, Human, N-Myc tag HG12127-NM
SOSTDC1 qPCR Primer Pairs, Human HP101653
info info
添加购物车成功! 添加购物车失败!