SORD cDNA ORF Clone, Human, N-Myc tag

Cat: HG15493-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SORD Reagents
CRO Services
Product recommended

All SORD Reagents
SORD cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1074 bp
Description
Full length Clone DNA of Human sorbitol dehydrogenase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SORD cDNA ORF Clone, Human, N-Myc tag Alternative Names
HEL-S-95n cDNA ORF Clone, Human;SORD1 cDNA ORF Clone, Human
SORD Background Information
Full Name
sorbitol dehydrogenase

SORD cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SORD cDNA ORF Clone in Cloning Vector, Rat RG81229-U
SORD cDNA ORF Clone, Rat, untagged RG81229-UT
SORD Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81229-ACGLN
SORD cDNA ORF Clone, Rat, C-GFPSpark® tag RG81229-ACG
SORD cDNA ORF Clone, Rat, N-GFPSpark® tag RG81229-ANG
SORD cDNA ORF Clone, Rat, C-OFPSpark® tag RG81229-ACR
SORD cDNA ORF Clone, Rat, N-OFPSpark® tag RG81229-ANR
SORD cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81229-CF
SORD cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81229-NF
SORD cDNA ORF Clone, Rat, C-His tag RG81229-CH
SORD cDNA ORF Clone, Rat, N-His tag RG81229-NH
SORD cDNA ORF Clone, Rat, C-HA tag RG81229-CY
SORD cDNA ORF Clone, Rat, N-HA tag RG81229-NY
SORD cDNA ORF Clone, Rat, C-Myc tag RG81229-CM
SORD cDNA ORF Clone, Rat, N-Myc tag RG81229-NM
SORD qPCR Primer Pairs, Rat RP301185

SORD cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SORD cDNA ORF Clone in Cloning Vector, Mouse MG53907-U
SORD cDNA ORF Clone, Mouse, untagged MG53907-UT
SORD Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53907-ACGLN
SORD cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53907-ACG
SORD cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53907-ANG
SORD cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53907-ACR
SORD cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53907-ANR
SORD cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53907-CF
SORD cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53907-NF
SORD cDNA ORF Clone, Mouse, C-His tag MG53907-CH
SORD cDNA ORF Clone, Mouse, N-His tag MG53907-NH
SORD cDNA ORF Clone, Mouse, C-HA tag MG53907-CY
SORD cDNA ORF Clone, Mouse, N-HA tag MG53907-NY
SORD cDNA ORF Clone, Mouse, C-Myc tag MG53907-CM
SORD cDNA ORF Clone, Mouse, N-Myc tag MG53907-NM

SORD cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SORD cDNA ORF Clone in Cloning Vector, Human HG15493-G
SORD cDNA ORF Clone, Human, untagged HG15493-UT
SORD cDNA ORF Clone, Human, C-GFPSpark® tag HG15493-ACG
SORD Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15493-ACGLN
SORD cDNA ORF Clone, Human, N-GFPSpark® tag HG15493-ANG
SORD cDNA ORF Clone, Human, C-OFPSpark® tag HG15493-ACR
SORD cDNA ORF Clone, Human, N-OFPSpark® tag HG15493-ANR
SORD cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15493-CF
SORD cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15493-NF
SORD cDNA ORF Clone, Human, C-His tag HG15493-CH
SORD cDNA ORF Clone, Human, N-His tag HG15493-NH
SORD cDNA ORF Clone, Human, C-HA tag HG15493-CY
SORD cDNA ORF Clone, Human, N-HA tag HG15493-NY
SORD cDNA ORF Clone, Human, C-Myc tag HG15493-CM
SORD qPCR Primer Pairs, Human HP104115
info info
添加购物车成功! 添加购物车失败!