SOD2 cDNA ORF Clone, Human, untagged

Cat: HG12061-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SOD2 Reagents
CRO Services
Product recommended

All SOD2 Reagents
SOD2 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
669 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human superoxide dismutase 2, mitochondrial.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI (6.1kb + 0.67kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
SOD2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SOD2 cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
SOD2 cDNA ORF Clone, Human, untagged Alternative Names
IPOB cDNA ORF Clone, Human;MNSOD cDNA ORF Clone, Human;MVCD6 cDNA ORF Clone, Human
SOD2 Background Information

Superoxide dismutases (SOD) are important anti-oxidant enzymes that guard against superoxide toxicity. In humans, as in all mammals and most chordates, three forms of superoxide dismutase (SOD) are present: SOD1 is located in the cytoplasm, SOD2 in the mitochondria, and SOD3 is extracellular. Mitochondrial superoxide dismutase [SOD; manganese SOD (MnSOD) or SOD2] neutralizes highly reactive superoxide radical (O(

Full Name
superoxide dismutase 2, mitochondrial
References
  • Culotta VC, et al. (2006) Activation of superoxide dismutases: putting the metal to the pedal. Biochim Biophys Acta. 1763(7): 747-58.
  • Bag A, et al. (2008) Target sequence polymorphism of human manganese superoxide dismutase gene and its association with cancer risk: a review. Cancer Epidemiol Biomarkers Prev. 17(12): 3298-305.
  • Diehl C, et al. (2009) The basis of topical superoxide dismutase antipruritic activity. Acta Dermatovenerol Croat. 17(1): 25-39.
  • Ma X, et al. (2010) No association between SOD2 Val16Ala polymorphism and breast cancer susceptibility: a meta-analysis based on 9,710 cases and 11,041 controls. Breast Cancer Res Treat. 122(2): 509-14.
  • SOD2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    SOD2 cDNA ORF Clone in Cloning Vector, Rat RG81842-U
    SOD2 cDNA ORF Clone, Rat, untagged RG81842-UT
    SOD2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81842-ACG
    SOD2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81842-ACGLN
    SOD2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81842-ANG
    SOD2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81842-ACR
    SOD2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81842-ANR
    SOD2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81842-CF
    SOD2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81842-NF
    SOD2 cDNA ORF Clone, Rat, C-His tag RG81842-CH
    SOD2 cDNA ORF Clone, Rat, N-His tag RG81842-NH
    SOD2 cDNA ORF Clone, Rat, C-HA tag RG81842-CY
    SOD2 cDNA ORF Clone, Rat, N-HA tag RG81842-NY
    SOD2 cDNA ORF Clone, Rat, C-Myc tag RG81842-CM
    SOD2 cDNA ORF Clone, Rat, N-Myc tag RG81842-NM

    SOD2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SOD2 cDNA ORF Clone in Cloning Vector, Mouse MG52414-G
    SOD2 cDNA ORF Clone, Mouse, untagged MG52414-UT
    SOD2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52414-ACGLN
    SOD2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52414-ACG
    SOD2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52414-ANG
    SOD2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52414-ACR
    SOD2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52414-ANR
    SOD2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52414-CF
    SOD2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52414-NF
    SOD2 cDNA ORF Clone, Mouse, C-His tag MG52414-CH
    SOD2 cDNA ORF Clone, Mouse, N-His tag MG52414-NH
    SOD2 cDNA ORF Clone, Mouse, C-HA tag MG52414-CY
    SOD2 cDNA ORF Clone, Mouse, N-HA tag MG52414-NY
    SOD2 cDNA ORF Clone, Mouse, C-Myc tag MG52414-CM
    SOD2 cDNA ORF Clone, Mouse, N-Myc tag MG52414-NM
    SOD2 qPCR Primer Pairs, Mouse MP202287

    SOD2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SOD2 cDNA ORF Clone in Cloning Vector, Human HG29745-U
    SOD2 cDNA ORF Clone in Cloning Vector, Human HG12061-G
    SOD2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12061-ACGLN
    SOD2 cDNA ORF Clone, Human, C-GFPSpark® tag HG12061-ACG
    SOD2 cDNA ORF Clone, Human, N-GFPSpark® tag HG12061-ANG
    SOD2 cDNA ORF Clone, Human, C-OFPSpark® tag HG12061-ACR
    SOD2 cDNA ORF Clone, Human, N-OFPSpark® tag HG12061-ANR
    SOD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12061-CF
    SOD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12061-NF
    SOD2 cDNA ORF Clone, Human, C-His tag HG12061-CH
    SOD2 cDNA ORF Clone, Human, N-His tag HG12061-NH
    SOD2 cDNA ORF Clone, Human, C-HA tag HG12061-CY
    SOD2 cDNA ORF Clone, Human, N-HA tag HG12061-NY
    SOD2 cDNA ORF Clone, Human, C-Myc tag HG12061-CM
    SOD2 cDNA ORF Clone, Human, N-Myc tag HG12061-NM
    SOD2 qPCR Primer Pairs, Human HP101592
    info info
    添加购物车成功! 添加购物车失败!