Quick Order

Human SOD1 Gene ORF cDNA clone expression plasmid, C-Flag tag

  • Human SOD1 natural ORF mammalian expression plasmid, C-Flag tag
  • Human SOD1 ORF mammalian expression plasmid, C-Flag tag
DatasheetReviewsRelated ProductsProtocols
Human SOD1 cDNA Clone Product Information
NCBI RefSeq:NM_000454
RefSeq ORF Size:465bp
cDNA Description:Full length Clone DNA of Homo sapiens superoxide dismutase 1, soluble with C terminal Flag tag.
Gene Synonym:IPOA
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-SOD1-Flag
Restriction Site:KpnI + XbaI (6kb + 0.5kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with SOD1 qPCR primers for gene expression analysis, HP100037 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human SOD1 Gene Plasmid Map
Human SOD1 natural ORF mammalian expression plasmid, C-Flag tag
Human SOD1 Gene Expression validated Image
Human SOD1 ORF mammalian expression plasmid, C-Flag tag
[Click to enlarge image]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

SOD1 belongs to the Cu-Zn superoxide dismutase family. It binds copper and zinc ions and is one of two isozymes responsible for destroying free superoxide radicals in the body. The encoded isozyme is a soluble cytoplasmic protein, acting as a homodimer to convert naturally-occuring but harmful superoxide radicals to molecular oxygen and hydrogen peroxide. The other isozyme is a mitochondrial protein. Mutations in this gene have been implicated as causes of familial amyotrophic lateral sclerosis. Rare transcript variants have been reported for this gene. SOD1 destroys radicals which are normally produced within the cells and which are toxic to biological systems. Defects in SOD1 are the cause of amyotrophic lateral sclerosis type 1 (ALS1). ALS1 is a familial form of amyotrophic lateral sclerosis, a neurodegenerative disorder affecting upper and lower motor neurons and resulting in fatal paralysis. Sensory abnormalities are absent. Death usually occurs within 2 to 5 years. The etiology of amyotrophic lateral sclerosis is likely to be multifactorial, involving both genetic and environmental factors. The disease is inherited in 5-10% of cases leading to familial forms.

References
  • Murakami K, et al. (2011) SOD1 (copper/zinc superoxide dismutase) deficiency drives amyloid β protein oligomerization and memory loss in mouse model of Alzheimer disease. J Biol Chem. 286(52):44557-68.
  • Thompson M, et al. (2012) Paradoxical roles of serine racemase and D-serine in the G93A mSOD1 mouse model of amyotrophic lateral sclerosis. J Neurochem. 120(4):598-610.
  • Magrané J, et al. (2012) Mitochondrial dynamics and bioenergetic dysfunction is associated with synaptic alterations in mutant SOD1 motor neurons. J Neurosci. 32(1):229-42.
  • Gertz B, et al. (2012) Nuclear localization of human SOD1 and mutant SOD1-specific disruption of survival motor neuron protein complex in transgenic amyotrophic lateral sclerosis mice. J Neuropathol Exp Neurol. 71(2):162-77.
  • Size / Price
    Catalog: HG11727-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"