SOCS2 cDNA ORF Clone, Human, C-Myc tag

Cat: HG11285-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SOCS2 Reagents
CRO Services
Product recommended

All SOCS2 Reagents
SOCS2 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
597 bp
Description
Full length Clone DNA of Human suppressor of cytokine signaling 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SOCS2 cDNA ORF Clone, Human, C-Myc tag Alternative Names
CIS2 cDNA ORF Clone, Human;Cish2 cDNA ORF Clone, Human;SOCS-2 cDNA ORF Clone, Human;SSI-2 cDNA ORF Clone, Human;SSI2 cDNA ORF Clone, Human;STATI2 cDNA ORF Clone, Human
SOCS2 Background Information
Full Name
suppressor of cytokine signaling 2

SOCS2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SOCS2 cDNA ORF Clone in Cloning Vector, Mouse MG51835-G
SOCS2 cDNA ORF Clone, Mouse, untagged MG51835-UT
SOCS2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51835-ACGLN
SOCS2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51835-ACG
SOCS2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51835-ANG
SOCS2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51835-ACR
SOCS2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51835-ANR
SOCS2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51835-CF
SOCS2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51835-NF
SOCS2 cDNA ORF Clone, Mouse, C-His tag MG51835-CH
SOCS2 cDNA ORF Clone, Mouse, N-His tag MG51835-NH
SOCS2 cDNA ORF Clone, Mouse, C-HA tag MG51835-CY
SOCS2 cDNA ORF Clone, Mouse, N-HA tag MG51835-NY
SOCS2 cDNA ORF Clone, Mouse, C-Myc tag MG51835-CM
SOCS2 cDNA ORF Clone, Mouse, N-Myc tag MG51835-NM
SOCS2 qPCR Primer Pairs, Mouse MP201708

SOCS2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SOCS2 cDNA ORF Clone in Cloning Vector, Human HG11285-M
SOCS2 cDNA ORF Clone, Human, untagged HG11285-UT
SOCS2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11285-ACG
SOCS2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11285-ACGLN
SOCS2 cDNA ORF Clone, Human, N-GFPSpark® tag HG11285-ANG
SOCS2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11285-ACR
SOCS2 cDNA ORF Clone, Human, N-OFPSpark® tag HG11285-ANR
SOCS2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11285-CF
SOCS2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11285-NF
SOCS2 cDNA ORF Clone, Human, C-His tag HG11285-CH
SOCS2 cDNA ORF Clone, Human, N-His tag HG11285-NH
SOCS2 cDNA ORF Clone, Human, C-HA tag HG11285-CY
SOCS2 cDNA ORF Clone, Human, N-HA tag HG11285-NY
SOCS2 cDNA ORF Clone, Human, N-Myc tag HG11285-NM
SOCS2 qPCR Primer Pairs, Human HP101163
info info
添加购物车成功! 添加购物车失败!