SNX4 cDNA ORF Clone, Human, N-His tag

Cat: HG14336-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SNX4 Reagents
CRO Services
Product recommended

All SNX4 Reagents
SNX4 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1353 bp
Description
Full length Clone DNA of Human sorting nexin 4 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SNX4 cDNA ORF Clone, Human, N-His tag Alternative Names
ATG24B cDNA ORF Clone, Human
SNX4 Background Information
Full Name
sorting nexin 4

SNX4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SNX4 cDNA ORF Clone in Cloning Vector, Rat RG8A0980-U
SNX4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0980-ACGLN

SNX4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SNX4 cDNA ORF Clone in Cloning Vector, Mouse MG52136-U
SNX4 cDNA ORF Clone, Mouse, untagged MG52136-UT
SNX4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52136-ACG
SNX4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52136-ACGLN
SNX4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52136-ANG
SNX4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52136-ACR
SNX4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52136-ANR
SNX4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52136-CF
SNX4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52136-NF
SNX4 cDNA ORF Clone, Mouse, C-His tag MG52136-CH
SNX4 cDNA ORF Clone, Mouse, N-His tag MG52136-NH
SNX4 cDNA ORF Clone, Mouse, C-HA tag MG52136-CY
SNX4 cDNA ORF Clone, Mouse, N-HA tag MG52136-NY
SNX4 cDNA ORF Clone, Mouse, C-Myc tag MG52136-CM
SNX4 cDNA ORF Clone, Mouse, N-Myc tag MG52136-NM
SNX4 qPCR Primer Pairs, Mouse MP202009

SNX4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SNX4 cDNA ORF Clone in Cloning Vector, Human HG14336-G
SNX4 cDNA ORF Clone, Human, untagged HG14336-UT
SNX4 cDNA ORF Clone, Human, C-GFPSpark® tag HG14336-ACG
SNX4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14336-ACGLN
SNX4 cDNA ORF Clone, Human, N-GFPSpark® tag HG14336-ANG
SNX4 cDNA ORF Clone, Human, C-OFPSpark® tag HG14336-ACR
SNX4 cDNA ORF Clone, Human, N-OFPSpark® tag HG14336-ANR
SNX4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14336-CF
SNX4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14336-NF
SNX4 cDNA ORF Clone, Human, C-His tag HG14336-CH
SNX4 cDNA ORF Clone, Human, C-HA tag HG14336-CY
SNX4 cDNA ORF Clone, Human, N-HA tag HG14336-NY
SNX4 cDNA ORF Clone, Human, C-Myc tag HG14336-CM
SNX4 cDNA ORF Clone, Human, N-Myc tag HG14336-NM
SNX4 qPCR Primer Pairs, Human HP102986
info info
添加购物车成功! 添加购物车失败!