SNX1 cDNA ORF Clone, Human, untagged

Cat: HG14474-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SNX1 Reagents
CRO Services
Product recommended

All SNX1 Reagents
SNX1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1569 bp
Description
Full length Clone DNA of Human sorting nexin 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SNX1 cDNA ORF Clone, Human, untagged Alternative Names
HsT17379 cDNA ORF Clone, Human;VPS5 cDNA ORF Clone, Human
SNX1 Background Information
Full Name
sorting nexin 1

SNX1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SNX1 cDNA ORF Clone in Cloning Vector, Mouse MG52053-G
SNX1 cDNA ORF Clone, Mouse, untagged MG52053-UT
SNX1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52053-ACGLN
SNX1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52053-ACG
SNX1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52053-ANG
SNX1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52053-ACR
SNX1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52053-ANR
SNX1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52053-CF
SNX1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52053-NF
SNX1 cDNA ORF Clone, Mouse, C-His tag MG52053-CH
SNX1 cDNA ORF Clone, Mouse, N-His tag MG52053-NH
SNX1 cDNA ORF Clone, Mouse, C-HA tag MG52053-CY
SNX1 cDNA ORF Clone, Mouse, N-HA tag MG52053-NY
SNX1 cDNA ORF Clone, Mouse, C-Myc tag MG52053-CM
SNX1 cDNA ORF Clone, Mouse, N-Myc tag MG52053-NM
SNX1 qPCR Primer Pairs, Mouse MP201926

SNX1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SNX1 cDNA ORF Clone in Cloning Vector, Human HG14474-G
SNX1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14474-ACGLN
SNX1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14474-ACG
SNX1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14474-ANG
SNX1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14474-ACR
SNX1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14474-ANR
SNX1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14474-CF
SNX1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14474-NF
SNX1 cDNA ORF Clone, Human, C-His tag HG14474-CH
SNX1 cDNA ORF Clone, Human, N-His tag HG14474-NH
SNX1 cDNA ORF Clone, Human, C-HA tag HG14474-CY
SNX1 cDNA ORF Clone, Human, N-HA tag HG14474-NY
SNX1 cDNA ORF Clone, Human, C-Myc tag HG14474-CM
SNX1 cDNA ORF Clone, Human, N-Myc tag HG14474-NM
SNX1 qPCR Primer Pairs, Human HP103122
info info
添加购物车成功! 添加购物车失败!