alpha-Synuclein cDNA ORF Clone, Human, N-HA tag

Cat: HG12093-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All alpha-Synuclein Reagents

CRO Services

Product recommended


All alpha-Synuclein Reagents

alpha-Synuclein cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
465 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human synuclein, alpha (non A4 component of amyloid precursor) with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.47kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

alpha-Synuclein cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

alpha-Synuclein cDNA ORF Clone, Human, N-HA tag Validated Images

Cynomolgus LOC101926731 Gene Plasmid Map 5628

alpha-Synuclein cDNA ORF Clone, Human, N-HA tag Alternative Names

NACP cDNA ORF Clone, Human;PARK1 cDNA ORF Clone, Human;PARK4 cDNA ORF Clone, Human;PD1 cDNA ORF Clone, Human

alpha-Synuclein Background Information

Alpha-Synuclein (alpha-Syn), also known as NACP or SNCA, exists as at least two structural isoforms: one is helix-rich, membrane-bound form that both the N- and C-terminal regions of alpha-synuclein are tightly associated with membranes and the other is disordered, cytosolic form. Synuclein is found predominantly in the presynaptic termini, in both free or membrane-bound forms. SNCA is extensively localized in nucleus of neurons. It has been shown that alpha-Synuclein was highly expressed in the mitochondria in olfactory bulb, hippocampus, striatum, and thalamus, where the cytosolic alpha-Synuclein was also rich. Normally the unstructured soluble type of alpha-synuclein can aggregate to form insoluble fibrils in pathological conditions characterized by Lewy bodies, such as Parkinson's disease, dementia with Lewy bodies and multiple system atrophy. SNCA abnormality and mitochondrial deficiency are two major changes in the brain of patients with Parkinson's disease (PD). In addition, alpha-synuclein is an abundant component of Lewy bodies in sporadic Parkinson's disease and diffuse Lewy body disease.

Full Name
synuclein, alpha (non A4 component of amyloid precursor)
References
  • Arima K, et al. (1998) Immunoelectron-microscopic demonstration of NACP / alpha-synuclein-epitopes onthe filamentous component of Lewy bodies in Parkinson's disease and in dementia with Lewy bodies. Brain Res. 808 (1): 93-100.
  • Arima K, et al. (1998) NACP / alpha-synuclein immunoreactivity in fibrillary components of neuronal and oligodendroglial cytoplasmic inclusions in the pontine nuclei in multiple system atrophy. Acta Neuropathol. 96 (5): 439-44.
  • Lee HJ, et al. (2001) Membrane-bound alpha-Synuclein Has a High Aggregation Propensity and the Ability to Seed the Aggregation of the Cytosolic Form. The Journal of Biological Chemistry. 277: 671-8.
  • alpha-Synuclein cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    alpha-Synuclein cDNA ORF Clone in Cloning Vector, Canine DG70149-U

    alpha-Synuclein cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    alpha-Synuclein cDNA ORF Clone in Cloning Vector, Mouse MG57031-U
    alpha-Synuclein cDNA ORF Clone, Mouse, untagged MG57031-UT
    alpha-Synuclein Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57031-ACGLN
    alpha-Synuclein cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57031-ACG
    alpha-Synuclein cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57031-ANG
    alpha-Synuclein cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57031-ACR
    alpha-Synuclein cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57031-ANR
    alpha-Synuclein cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57031-CF
    alpha-Synuclein cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57031-NF
    alpha-Synuclein cDNA ORF Clone, Mouse, C-His tag MG57031-CH
    alpha-Synuclein cDNA ORF Clone, Mouse, N-His tag MG57031-NH
    alpha-Synuclein cDNA ORF Clone, Mouse, C-HA tag MG57031-CY
    alpha-Synuclein cDNA ORF Clone, Mouse, N-HA tag MG57031-NY
    alpha-Synuclein cDNA ORF Clone, Mouse, C-Myc tag MG57031-CM
    alpha-Synuclein cDNA ORF Clone, Mouse, N-Myc tag MG57031-NM

    alpha-Synuclein cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    alpha-Synuclein cDNA ORF Clone in Cloning Vector, Human HG12093-G
    alpha-Synuclein cDNA ORF Clone, Human, untagged HG12093-UT
    alpha-Synuclein Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12093-ACGLN
    alpha-Synuclein cDNA ORF Clone, Human, C-GFPSpark® tag HG12093-ACG
    alpha-Synuclein cDNA ORF Clone, Human, N-GFPSpark® tag HG12093-ANG
    alpha-Synuclein cDNA ORF Clone, Human, C-OFPSpark® tag HG12093-ACR
    alpha-Synuclein cDNA ORF Clone, Human, N-OFPSpark® tag HG12093-ANR
    alpha-Synuclein cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12093-CF
    alpha-Synuclein cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12093-NF
    alpha-Synuclein cDNA ORF Clone, Human, C-His tag HG12093-CH
    alpha-Synuclein cDNA ORF Clone, Human, N-His tag HG12093-NH
    alpha-Synuclein cDNA ORF Clone, Human, C-HA tag HG12093-CY
    alpha-Synuclein cDNA ORF Clone, Human, C-Myc tag HG12093-CM
    alpha-Synuclein cDNA ORF Clone, Human, N-Myc tag HG12093-NM
    alpha-Synuclein qPCR Primer Pairs, Human HP101621
    info info
    添加购物车成功! 添加购物车失败!