Quick Order

Text Size:AAA

Human SNCA/alpha-Synuclein Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human SNCA cDNA Clone Product Information
NCBI RefSeq:NM_000345.3
RefSeq ORF Size:423bp
cDNA Description:Full length Clone DNA of Homo sapiens synuclein, alpha (non A4 component of amyloid precursor) with C terminal His tag.
Gene Synonym:PD1, NACP, PARK1, PARK4, MGC110988, SNCA
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Alpha-Synuclein (alpha-Syn), also known as NACP or SNCA, exists as at least two structural isoforms: one is helix-rich, membrane-bound form that both the N- and C-terminal regions of alpha-synuclein are tightly associated with membranes and the other is disordered, cytosolic form. Synuclein is found predominantly in the presynaptic termini, in both free or membrane-bound forms. SNCA is extensively localized in nucleus of neurons. It has been shown that alpha-Synuclein was highly expressed in the mitochondria in olfactory bulb, hippocampus, striatum, and thalamus, where the cytosolic alpha-Synuclein was also rich. Normally the unstructured soluble type of alpha-synuclein can aggregate to form insoluble fibrils in pathological conditions characterized by Lewy bodies, such as Parkinson's disease, dementia with Lewy bodies and multiple system atrophy. SNCA abnormality and mitochondrial deficiency are two major changes in the brain of patients with Parkinson's disease (PD). In addition, alpha-synuclein is an abundant component of Lewy bodies in sporadic Parkinson's disease and diffuse Lewy body disease.

References
  • Arima K, et al. (1998) Immunoelectron-microscopic demonstration of NACP / alpha-synuclein-epitopes onthe filamentous component of Lewy bodies in Parkinson's disease and in dementia with Lewy bodies. Brain Res. 808 (1): 93-100.
  • Arima K, et al. (1998) NACP / alpha-synuclein immunoreactivity in fibrillary components of neuronal and oligodendroglial cytoplasmic inclusions in the pontine nuclei in multiple system atrophy. Acta Neuropathol. 96 (5): 439-44.
  • Lee HJ, et al. (2001) Membrane-bound alpha-Synuclein Has a High Aggregation Propensity and the Ability to Seed the Aggregation of the Cytosolic Form. The Journal of Biological Chemistry. 277: 671-8.
  • Size / Price
    Catalog: HG12093-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"