SLUG cDNA ORF Clone, Human, C-His tag

Cat: HG11196-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SLUG Reagents
CRO Services
Product recommended

All SLUG Reagents
SLUG cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
852 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human snail homolog 2 (Drosophila) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Restriction Sites
KpnI + NotI(6kb+0.85kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
SLUG cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLUG cDNA ORF Clone, Human, C-His tag Validated Images
Human IL12A / IL-12A Gene Plasmid Map 5643
SLUG cDNA ORF Clone, Human, C-His tag Alternative Names
SLUG cDNA ORF Clone, Human;SLUGH1 cDNA ORF Clone, Human;SNAIL2 cDNA ORF Clone, Human;WS2D cDNA ORF Clone, Human
SLUG Background Information
Full Name
snail family zinc finger 2

SLUG cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SLUG cDNA ORF Clone in Cloning Vector, Rat RG87146-U
SLUG Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87146-ACGLN

SLUG cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLUG cDNA ORF Clone, Mouse, untagged MG57618-UT
SLUG Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57618-ACGLN
SLUG cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57618-ACG
SLUG cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57618-ANG
SLUG cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57618-ACR
SLUG cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57618-ANR
SLUG cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57618-CF
SLUG cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57618-NF
SLUG cDNA ORF Clone, Mouse, C-His tag MG57618-CH
SLUG cDNA ORF Clone, Mouse, N-His tag MG57618-NH
SLUG cDNA ORF Clone, Mouse, C-HA tag MG57618-CY
SLUG cDNA ORF Clone, Mouse, N-HA tag MG57618-NY
SLUG cDNA ORF Clone, Mouse, C-Myc tag MG57618-CM
SLUG cDNA ORF Clone, Mouse, N-Myc tag MG57618-NM

SLUG cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SLUG cDNA ORF Clone in Cloning Vector, Human HG11196-M
SLUG cDNA ORF Clone, Human, untagged HG11196-UT
SLUG Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11196-ACGLN
SLUG cDNA ORF Clone, Human, C-GFPSpark® tag HG11196-ACG
SLUG cDNA ORF Clone, Human, N-GFPSpark® tag HG11196-ANG
SLUG cDNA ORF Clone, Human, C-OFPSpark® tag HG11196-ACR
SLUG cDNA ORF Clone, Human, N-OFPSpark® tag HG11196-ANR
SLUG cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11196-CF
SLUG cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11196-NF
SLUG cDNA ORF Clone, Human, N-His tag HG11196-NH
SLUG cDNA ORF Clone, Human, C-HA tag HG11196-CY
SLUG cDNA ORF Clone, Human, N-HA tag HG11196-NY
SLUG cDNA ORF Clone, Human, C-Myc tag HG11196-CM
SLUG cDNA ORF Clone, Human, N-Myc tag HG11196-NM
SLUG qPCR Primer Pairs, Human HP101101
info info
添加购物车成功! 添加购物车失败!