SMYD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11093-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SMYD2 Reagents
CRO Services
Product recommended

All SMYD2 Reagents
SMYD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1302 bp
Description
Full length Clone DNA of Human SET and MYND domain containing 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SMYD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
HSKM-B cDNA ORF Clone, Human;KMT3C cDNA ORF Clone, Human;ZMYND14 cDNA ORF Clone, Human
SMYD2 Background Information

SET and MYND domain-containing protein 2, also known as HSKM-B, SMYD2, and KMT3C, is a member of the SMYD protein family. It contains one MYND-type zinc finger and one SET domain. Not much is known about SMYD2. However, the interest in better understanding the roles of SMYD2 has grown because of reports indicating that SMYD2 methylates p53 and histone H3. In Xenopus, SMYD1 and SMYD2 were expressed in various muscle tissues and related to muscle cells differentiation. SMYD2 mRNA is most highly expressed in heart and brain tissue. Over-expressed SMYD2 localizes to the cytoplasm and the nucleus in 293T cells. SMYD2 appears to restrain cell proliferation, likely through direct modulation of chromatin structure. Patients with SMYD2-overexpressing tumors had a worse overall rate of survival than those with non-expressing tumors, and SMYD2 positivity was independently associated with a worse outcome in the multivariate analysis. SMYD2 plays an important role in tumor cell proliferation through its activation/overexpression and regards as a prognosticator and potential therapeutic target in esophageal squamous cell carcinoma (ESCC).

Full Name
SET and MYND domain containing 2
References
  • Zakut-Houri R., et al.,(1985), Human p53 cellular tumor antigen: cDNA sequence and expression in COS cells. EMBO J. 4:1251-1255.
  • Lamb P., et al., (1986), Characterization of the human p53 gene.Mol. Cell. Biol. 6:1379-1385.
  • Harlow E., et al.,(1985), Molecular cloning and in vitro expression of a cDNA clone for human cellular tumor antigen p53.Mol. Cell. Biol. 5:1601-1610.
  • info info
    添加购物车成功! 添加购物车失败!