SMOC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG12012-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SMOC2 Reagents
CRO Services
Product recommended

All SMOC2 Reagents
SMOC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1413 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human SPARC related modular calcium binding 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI(6kb+1.41kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
SMOC2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SMOC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
SMOC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
bA270C4A.1 cDNA ORF Clone, Human;bA37D8.1 cDNA ORF Clone, Human;dJ421D16.1 cDNA ORF Clone, Human;DTDP1 cDNA ORF Clone, Human;MST117 cDNA ORF Clone, Human;MSTP117 cDNA ORF Clone, Human;MSTP140 cDNA ORF Clone, Human;SMAP2 cDNA ORF Clone, Human
SMOC2 Background Information
Full Name
SPARC related modular calcium binding 2

SMOC2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SMOC2 cDNA ORF Clone in Cloning Vector, Rat RG80834-U
SMOC2 cDNA ORF Clone, Rat, untagged RG80834-UT
SMOC2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80834-ACGLN
SMOC2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80834-ACG
SMOC2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80834-ACR
SMOC2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80834-CF
SMOC2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80834-NF
SMOC2 cDNA ORF Clone, Rat, C-His tag RG80834-CH
SMOC2 cDNA ORF Clone, Rat, N-His tag RG80834-NH
SMOC2 cDNA ORF Clone, Rat, C-HA tag RG80834-CY
SMOC2 cDNA ORF Clone, Rat, N-HA tag RG80834-NY
SMOC2 cDNA ORF Clone, Rat, C-Myc tag RG80834-CM
SMOC2 cDNA ORF Clone, Rat, N-Myc tag RG80834-NM
SMOC2 qPCR Primer Pairs, Rat RP300798

SMOC2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SMOC2 cDNA ORF Clone in Cloning Vector, Mouse MG5A0991-U
SMOC2 cDNA ORF Clone, Mouse, untagged MG5A0991-UT
SMOC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0991-ACG
SMOC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0991-ACGLN
SMOC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0991-ACR
SMOC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0991-CF
SMOC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0991-NF
SMOC2 cDNA ORF Clone, Mouse, C-His tag MG5A0991-CH
SMOC2 cDNA ORF Clone, Mouse, N-His tag MG5A0991-NH
SMOC2 cDNA ORF Clone, Mouse, C-HA tag MG5A0991-CY
SMOC2 cDNA ORF Clone, Mouse, N-HA tag MG5A0991-NY
SMOC2 cDNA ORF Clone, Mouse, C-Myc tag MG5A0991-CM
SMOC2 cDNA ORF Clone, Mouse, N-Myc tag MG5A0991-NM

SMOC2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SMOC2 cDNA ORF Clone in Cloning Vector, Human HG12012-G
SMOC2 cDNA ORF Clone, Human, untagged HG12012-UT
SMOC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12012-ACGLN
SMOC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG12012-ACG
SMOC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG12012-ACR
SMOC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12012-G-F
SMOC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12012-NF
SMOC2 cDNA ORF Clone, Human, C-His tag HG12012-CH
SMOC2 cDNA ORF Clone, Human, N-His tag HG12012-NH
SMOC2 cDNA ORF Clone, Human, C-HA tag HG12012-CY
SMOC2 cDNA ORF Clone, Human, N-HA tag HG12012-NY
SMOC2 cDNA ORF Clone, Human, C-Myc tag HG12012-CM
SMOC2 cDNA ORF Clone, Human, N-Myc tag HG12012-NM
SMOC2 qPCR Primer Pairs, Human HP101671
info info
添加购物车成功! 添加购物车失败!