Quick Order

Text Size:AAA

Human SMNDC1/ SPF30 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human SMNDC1 cDNA Clone Product Information
NCBI RefSeq:BC011234
RefSeq ORF Size:717bp
cDNA Description:Full length Clone DNA of Homo sapiens survival motor neuron domain containing 1.
Gene Synonym:SMNR, SPF30, SMNDC1
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

SMNDC1 gene is a paralog of SMN1 gene, which encodes the survival motor neuron protein, mutations in which are cause of autosomal recessive proximal spinal muscular atrophy. SMNDC1 is a nuclear protein that has been identified as a constituent of the spliceosome complex. SMNDC1 gene is differentially expressed, with abundant levels in skeletal muscle, and may share similar cellular function as the SMN1 gene. SMNDC1 is necessary for spliceosome assembly. Its overexpression causes apoptosis.

References
  • Rappsilber J, et al. (2001) SPF30 is an essential human splicing factor required for assembly of the U4/U5/U6 tri-small nuclear ribonucleoprotein into the spliceosome. J Biol Chem. 276(33): 31142-50.
  • Talbot K, et al. (1999) Characterization of a gene encoding survival motor neuron (SMN)-related protein, a constituent of the spliceosome complex. Hum Mol Genet. 7(13): 2149-56.
  • Neubauer G, et al. (1998) Mass spectrometry and EST-database searching allows characterization of the multi-protein spliceosome complex. Nat Genet. 20(1):46-50.
  • Size / Price
    Catalog: HG14294-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"