C8orf40 cDNA ORF Clone, Human, C-HA tag

Cat: HG16394-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All C8orf40 Reagents
CRO Services
Product recommended

All C8orf40 Reagents
C8orf40 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
324 bp
Description
Full length Clone DNA of Human small integral membrane protein 19 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

C8orf40 cDNA ORF Clone, Human, C-HA tag Alternative Names
C8orf40 cDNA ORF Clone, Human
C8orf40 Background Information
Full Name
small integral membrane protein 19

C8orf40 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
C8orf40 cDNA ORF Clone in Cloning Vector, Mouse MG52569-G
C8orf40 cDNA ORF Clone, Mouse, untagged MG52569-UT
C8orf40 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52569-ACG
C8orf40 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52569-ACGLN
C8orf40 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52569-ANG
C8orf40 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52569-ACR
C8orf40 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52569-ANR
C8orf40 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52569-CF
C8orf40 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52569-NF
C8orf40 cDNA ORF Clone, Mouse, C-His tag MG52569-CH
C8orf40 cDNA ORF Clone, Mouse, N-His tag MG52569-NH
C8orf40 cDNA ORF Clone, Mouse, C-HA tag MG52569-CY
C8orf40 cDNA ORF Clone, Mouse, N-HA tag MG52569-NY
C8orf40 cDNA ORF Clone, Mouse, C-Myc tag MG52569-CM
C8orf40 cDNA ORF Clone, Mouse, N-Myc tag MG52569-NM
C8orf40 qPCR Primer Pairs, Mouse MP202441

C8orf40 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
C8orf40 cDNA ORF Clone in Cloning Vector, Human HG16394-G
C8orf40 cDNA ORF Clone, Human, untagged HG16394-UT
C8orf40 cDNA ORF Clone, Human, C-GFPSpark® tag HG16394-ACG
C8orf40 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16394-ACGLN
C8orf40 cDNA ORF Clone, Human, C-OFPSpark® tag HG16394-ACR
C8orf40 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16394-CF
C8orf40 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16394-NF
C8orf40 cDNA ORF Clone, Human, C-His tag HG16394-CH
C8orf40 cDNA ORF Clone, Human, N-His tag HG16394-NH
C8orf40 cDNA ORF Clone, Human, N-HA tag HG16394-NY
C8orf40 cDNA ORF Clone, Human, C-Myc tag HG16394-CM
C8orf40 cDNA ORF Clone, Human, N-Myc tag HG16394-NM
C8orf40 qPCR Primer Pairs, Human HP105143
info info
添加购物车成功! 添加购物车失败!