Smad2 cDNA ORF Clone, Human, C-HA tag

Cat: HG10016-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Smad2 Reagents
CRO Services
Product recommended

All Smad2 Reagents
Smad2 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1446 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human SMAD family member 2 (SMAD2), transcript variant 2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Restriction Sites
KpnI + XbaI(6kb+1.45kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Smad2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Smad2 cDNA ORF Clone, Human, C-HA tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5612
Smad2 cDNA ORF Clone, Human, C-HA tag Alternative Names
hMAD-2 cDNA ORF Clone, Human;hSMAD2 cDNA ORF Clone, Human;JV18 cDNA ORF Clone, Human;JV18-1 cDNA ORF Clone, Human;MADH2 cDNA ORF Clone, Human;MADR2 cDNA ORF Clone, Human
Smad2 Background Information

SMAD2 is a member of the SMAD family. Members of this family mediate signal transduction by the TGF-beta/activin/BMP-2/4 cytokine superfamily from receptor Ser/Thr protein kinases at the cell surface to the nucleus. SMAD2 mediates the signal of the TGF-beta, and therefore regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. SMAD2 is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. SMAD2 is the downstream signal transducers of TGF-beta-1 in human dental pulp cells. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. Phosphorylated SMAD2 is able to form a complex with SMAD4 or SARA. These complexes accumulate in the cell nucleus, where they are directly participating in the regulation of gene expression.

Full Name
SMAD family member 2
References
  • Feng. et al., 2002, Mol Cell. 9 (1): 133-43.
  • Zhu Y. et al., 1997, J Biol Chem. 272 (15): 10035-40.
  • Zi Z. et al., 2012, FEBS Lett. 586 (14): 1921-8.
  • Smad2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Smad2 cDNA ORF Clone in Cloning Vector, Mouse MG50727-G
    Smad2 cDNA ORF Clone, Mouse, untagged MG50727-UT
    Smad2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50727-ACG
    Smad2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50727-ACGLN
    Smad2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50727-ANG
    Smad2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50727-ACR
    Smad2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50727-ANR
    Smad2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50727-CF
    Smad2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50727-NF
    Smad2 cDNA ORF Clone, Mouse, C-His tag MG50727-CH
    Smad2 cDNA ORF Clone, Mouse, N-His tag MG50727-NH
    Smad2 cDNA ORF Clone, Mouse, C-HA tag MG50727-CY
    Smad2 cDNA ORF Clone, Mouse, N-HA tag MG50727-NY
    Smad2 cDNA ORF Clone, Mouse, C-Myc tag MG50727-CM
    Smad2 cDNA ORF Clone, Mouse, N-Myc tag MG50727-NM
    Smad2 qPCR Primer Pairs, Mouse MP200702

    Smad2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Smad2 cDNA ORF Clone in Cloning Vector, Human HG10016-M
    Smad2 cDNA ORF Clone, Human, untagged HG10016-UT
    Smad2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10016-ACG
    Smad2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10016-ACGLN
    Smad2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10016-ANG
    Smad2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10016-ACR
    Smad2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10016-ANR
    Smad2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10016-CF
    Smad2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10016-NF
    Smad2 cDNA ORF Clone, Human, C-His tag HG10016-CH
    Smad2 cDNA ORF Clone, Human, N-His tag HG10016-NH
    Smad2 cDNA ORF Clone, Human, N-HA tag HG10016-NY
    Smad2 cDNA ORF Clone, Human, C-Myc tag HG10016-CM
    Smad2 cDNA ORF Clone, Human, N-Myc tag HG10016-NM
    Smad2 qPCR Primer Pairs, Human HP100113
    info info
    添加购物车成功! 添加购物车失败!