Quick Order

Human Smad2 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human SMAD2 cDNA Clone Product Information
NCBI RefSeq:NM_001003652.2
RefSeq ORF Size:1404bp
cDNA Description:Full length Clone DNA of Homo sapiens SMAD family member 2 (SMAD2), transcript variant 2 with C terminal Myc tag.
Gene Synonym:Smad2, JV18, MADH2, MADR2, JV18-1, hMAD-2, hSMAD2
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

SMAD2 is a member of the SMAD family. Members of this family mediate signal transduction by the TGF-beta/activin/BMP-2/4 cytokine superfamily from receptor Ser/Thr protein kinases at the cell surface to the nucleus. SMAD2 mediates the signal of the TGF-beta, and therefore regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. SMAD2 is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. SMAD2 is the downstream signal transducers of TGF-beta-1 in human dental pulp cells. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. Phosphorylated SMAD2 is able to form a complex with SMAD4 or SARA. These complexes accumulate in the cell nucleus, where they are directly participating in the regulation of gene expression.

References
  • Feng. et al., 2002, Mol Cell. 9 (1): 133-43.
  • Zhu Y. et al., 1997, J Biol Chem. 272 (15): 10035-40.
  • Zi Z. et al., 2012, FEBS Lett. 586 (14): 1921-8.
  • Size / Price
    Catalog: HG10016-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"