Quick Order

Human Smad2 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human SMAD2 cDNA Clone Product Information
NCBI RefSeq:NM_001003652.2
RefSeq ORF Size:1404bp
cDNA Description:Full length Clone DNA of Homo sapiens SMAD family member 2 (SMAD2), transcript variant 2 with C terminal HA tag.
Gene Synonym:Smad2, JV18, MADH2, MADR2, JV18-1, hMAD-2, hSMAD2
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

SMAD2 is a member of the SMAD family. Members of this family mediate signal transduction by the TGF-beta/activin/BMP-2/4 cytokine superfamily from receptor Ser/Thr protein kinases at the cell surface to the nucleus. SMAD2 mediates the signal of the TGF-beta, and therefore regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. SMAD2 is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. SMAD2 is the downstream signal transducers of TGF-beta-1 in human dental pulp cells. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. Phosphorylated SMAD2 is able to form a complex with SMAD4 or SARA. These complexes accumulate in the cell nucleus, where they are directly participating in the regulation of gene expression.

References
  • Feng. et al., 2002, Mol Cell. 9 (1): 133-43.
  • Zhu Y. et al., 1997, J Biol Chem. 272 (15): 10035-40.
  • Zi Z. et al., 2012, FEBS Lett. 586 (14): 1921-8.
  • Size / Price
    Catalog: HG10016-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"