SLC2A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG12102-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SLC2A1 Reagents
CRO Services
Product recommended

All SLC2A1 Reagents
SLC2A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1479 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human solute carrier family 2 (facilitated glucose transporter), member 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.56kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
SLC2A1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLC2A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Rhesus CD64/Fc gamma RI Gene Plasmid Map 5614
Human SLC2A1 Gene Expression validated Image 16231
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
SLC2A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
DYT17 cDNA ORF Clone, Human;DYT18 cDNA ORF Clone, Human;DYT9 cDNA ORF Clone, Human;EIG12 cDNA ORF Clone, Human;GLUT cDNA ORF Clone, Human;GLUT-1 cDNA ORF Clone, Human;GLUT1 cDNA ORF Clone, Human;GLUT1DS cDNA ORF Clone, Human;HTLVR cDNA ORF Clone, Human;PED cDNA ORF Clone, Human
SLC2A1 Background Information
Full Name
solute carrier family 2 (facilitated glucose transporter), member 1

SLC2A1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
SLC2A1 cDNA ORF Clone in Cloning Vector, Rhesus CG90746-G
SLC2A1 cDNA ORF Clone, Rhesus, untagged CG90746-UT
SLC2A1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90746-ACG
SLC2A1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90746-ACGLN
SLC2A1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90746-ACR
SLC2A1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90746-CF
SLC2A1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90746-NF
SLC2A1 cDNA ORF Clone, Rhesus, C-His tag CG90746-CH
SLC2A1 cDNA ORF Clone, Rhesus, N-His tag CG90746-NH
SLC2A1 cDNA ORF Clone, Rhesus, C-HA tag CG90746-CY
SLC2A1 cDNA ORF Clone, Rhesus, N-HA tag CG90746-NY
SLC2A1 cDNA ORF Clone, Rhesus, C-Myc tag CG90746-CM
SLC2A1 cDNA ORF Clone, Rhesus, N-Myc tag CG90746-NM

SLC2A1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLC2A1 cDNA ORF Clone in Cloning Vector, Mouse MG57206-U
SLC2A1 cDNA ORF Clone, Mouse, untagged MG57206-UT
SLC2A1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57206-ACG
SLC2A1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57206-ACGLN
SLC2A1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57206-ANG
SLC2A1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57206-ACR
SLC2A1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57206-ANR
SLC2A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57206-CF
SLC2A1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57206-NF
SLC2A1 cDNA ORF Clone, Mouse, C-His tag MG57206-CH
SLC2A1 cDNA ORF Clone, Mouse, N-His tag MG57206-NH
SLC2A1 cDNA ORF Clone, Mouse, C-HA tag MG57206-CY
SLC2A1 cDNA ORF Clone, Mouse, N-HA tag MG57206-NY
SLC2A1 cDNA ORF Clone, Mouse, C-Myc tag MG57206-CM
SLC2A1 cDNA ORF Clone, Mouse, N-Myc tag MG57206-NM

SLC2A1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SLC2A1 cDNA ORF Clone in Cloning Vector, Human HG12102-G
SLC2A1 cDNA ORF Clone, Human, untagged HG12102-UT
SLC2A1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12102-ACG
SLC2A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12102-ACGLN
SLC2A1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12102-ACR
SLC2A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12102-CF
SLC2A1 cDNA ORF Clone, Human, C-His tag HG12102-CH
SLC2A1 cDNA ORF Clone, Human, N-His tag HG12102-NH
SLC2A1 cDNA ORF Clone, Human, C-HA tag HG12102-CY
SLC2A1 cDNA ORF Clone, Human, N-HA tag HG12102-NY
SLC2A1 cDNA ORF Clone, Human, C-Myc tag HG12102-CM
SLC2A1 cDNA ORF Clone, Human, N-Myc tag HG12102-NM
SLC2A1 qPCR Primer Pairs, Human HP101630
info info
添加购物车成功! 添加购物车失败!