Quick Order

Human SLC2A1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human SLC2A1 cDNA Clone Product Information
NCBI RefSeq:NM_006516
RefSeq ORF Size:1479bp
cDNA Description:Full length Clone DNA of Homo sapiens solute carrier family 2 (facilitated glucose transporter), member 1.
Gene Synonym:DYT18
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-SLC2A1
Restriction Site:KpnI + XbaI (6.1kb + 1.48kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG12102-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"