FATP4 cDNA ORF Clone, Human, N-Myc tag

Cat: HG13861-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FATP4 Reagents
CRO Services
Product recommended

All FATP4 Reagents
FATP4 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
714 bp
Description
Full length Clone DNA of Human solute carrier family 27 (fatty acid transporter), member 4 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FATP4 cDNA ORF Clone, Human, N-Myc tag Alternative Names
ACSVL4 cDNA ORF Clone, Human;FATP4 cDNA ORF Clone, Human;IPS cDNA ORF Clone, Human
FATP4 Background Information
Full Name
solute carrier family 27 (fatty acid transporter), member 4

FATP4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FATP4 cDNA ORF Clone in Cloning Vector, Mouse MG58694-U
FATP4 cDNA ORF Clone, Mouse, untagged MG58694-UT
FATP4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58694-ACG
FATP4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58694-ACGLN
FATP4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58694-ANG
FATP4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58694-ACR
FATP4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58694-ANR
FATP4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58694-CF
FATP4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58694-NF
FATP4 cDNA ORF Clone, Mouse, C-His tag MG58694-CH
FATP4 cDNA ORF Clone, Mouse, N-His tag MG58694-NH
FATP4 cDNA ORF Clone, Mouse, C-HA tag MG58694-CY
FATP4 cDNA ORF Clone, Mouse, N-HA tag MG58694-NY
FATP4 cDNA ORF Clone, Mouse, C-Myc tag MG58694-CM
FATP4 cDNA ORF Clone, Mouse, N-Myc tag MG58694-NM

FATP4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FATP4 cDNA ORF Clone in Cloning Vector, Human HG13861-G
FATP4 cDNA ORF Clone, Human, untagged HG13861-UT
FATP4 cDNA ORF Clone, Human, C-GFPSpark® tag HG13861-ACG
FATP4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13861-ACGLN
FATP4 cDNA ORF Clone, Human, C-OFPSpark® tag HG13861-ACR
FATP4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13861-CF
FATP4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13861-NF
FATP4 cDNA ORF Clone, Human, C-His tag HG13861-CH
FATP4 cDNA ORF Clone, Human, N-His tag HG13861-NH
FATP4 cDNA ORF Clone, Human, C-HA tag HG13861-CY
FATP4 cDNA ORF Clone, Human, N-HA tag HG13861-NY
FATP4 cDNA ORF Clone, Human, C-Myc tag HG13861-CM
FATP4 qPCR Primer Pairs, Human HP102533
info info
添加购物车成功! 添加购物车失败!