FATP2 cDNA ORF Clone, Human, N-His tag

Cat: HG13155-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FATP2 Reagents
CRO Services
Product recommended

All FATP2 Reagents
FATP2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1863 bp
Description
Full length Clone DNA of Human solute carrier family 27 (fatty acid transporter), member 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FATP2 cDNA ORF Clone, Human, N-His tag Alternative Names
ACSVL1 cDNA ORF Clone, Human;FACVL1 cDNA ORF Clone, Human;FATP2 cDNA ORF Clone, Human;hFACVL1 cDNA ORF Clone, Human;HsT17226 cDNA ORF Clone, Human;VLACS cDNA ORF Clone, Human;VLCS cDNA ORF Clone, Human
FATP2 Background Information
Full Name
solute carrier family 27 (fatty acid transporter), member 2
Research Areas

FATP2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FATP2 cDNA ORF Clone in Cloning Vector, Mouse MG53331-U
FATP2 cDNA ORF Clone, Mouse, untagged MG53331-UT
FATP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53331-ACGLN
FATP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53331-ACG
FATP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53331-ACR
FATP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53331-CF
FATP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53331-NF
FATP2 cDNA ORF Clone, Mouse, C-His tag MG53331-CH
FATP2 cDNA ORF Clone, Mouse, N-His tag MG53331-NH
FATP2 cDNA ORF Clone, Mouse, C-HA tag MG53331-CY
FATP2 cDNA ORF Clone, Mouse, N-HA tag MG53331-NY
FATP2 cDNA ORF Clone, Mouse, C-Myc tag MG53331-CM
FATP2 cDNA ORF Clone, Mouse, N-Myc tag MG53331-NM

FATP2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FATP2 cDNA ORF Clone in Cloning Vector, Human HG13155-U
FATP2 cDNA ORF Clone, Human, untagged HG13155-UT
FATP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13155-ACG
FATP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13155-ACGLN
FATP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13155-ACR
FATP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13155-CF
FATP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13155-NF
FATP2 cDNA ORF Clone, Human, C-His tag HG13155-CH
FATP2 cDNA ORF Clone, Human, C-HA tag HG13155-CY
FATP2 cDNA ORF Clone, Human, N-HA tag HG13155-NY
FATP2 cDNA ORF Clone, Human, C-Myc tag HG13155-CM
FATP2 cDNA ORF Clone, Human, N-Myc tag HG13155-NM
FATP2 qPCR Primer Pairs, Human HP101711
info info
添加购物车成功! 添加购物车失败!