SLC25A6 cDNA ORF Clone, Human, N-Myc tag

Cat: HG16213-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SLC25A6 Reagents
CRO Services
Product recommended

All SLC25A6 Reagents
SLC25A6 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
897 bp
Description
Full length Clone DNA of Human solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLC25A6 cDNA ORF Clone, Human, N-Myc tag Alternative Names
AAC3 cDNA ORF Clone, Human;ANT cDNA ORF Clone, Human;ANT 2 cDNA ORF Clone, Human;ANT 3 cDNA ORF Clone, Human;ANT3 cDNA ORF Clone, Human;ANT3Y cDNA ORF Clone, Human
SLC25A6 Background Information
Full Name
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6

SLC25A6 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
SLC25A6 cDNA ORF Clone in Cloning Vector, Rhesus CG90302-G
SLC25A6 cDNA ORF Clone, Rhesus, untagged CG90302-UT
SLC25A6 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90302-ACGLN
SLC25A6 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90302-ACG
SLC25A6 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90302-ANG
SLC25A6 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90302-ACR
SLC25A6 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90302-ANR
SLC25A6 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90302-CF
SLC25A6 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90302-NF
SLC25A6 cDNA ORF Clone, Rhesus, C-His tag CG90302-CH
SLC25A6 cDNA ORF Clone, Rhesus, N-His tag CG90302-NH
SLC25A6 cDNA ORF Clone, Rhesus, C-HA tag CG90302-CY
SLC25A6 cDNA ORF Clone, Rhesus, N-HA tag CG90302-NY
SLC25A6 cDNA ORF Clone, Rhesus, C-Myc tag CG90302-CM
SLC25A6 cDNA ORF Clone, Rhesus, N-Myc tag CG90302-NM

SLC25A6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SLC25A6 cDNA ORF Clone in Cloning Vector, Human HG16213-G
SLC25A6 cDNA ORF Clone, Human, untagged HG16213-UT
SLC25A6 cDNA ORF Clone, Human, C-GFPSpark® tag HG16213-ACG
SLC25A6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16213-ACGLN
SLC25A6 cDNA ORF Clone, Human, N-GFPSpark® tag HG16213-ANG
SLC25A6 cDNA ORF Clone, Human, C-OFPSpark® tag HG16213-ACR
SLC25A6 cDNA ORF Clone, Human, N-OFPSpark® tag HG16213-ANR
SLC25A6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16213-CF
SLC25A6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16213-NF
SLC25A6 cDNA ORF Clone, Human, C-His tag HG16213-CH
SLC25A6 cDNA ORF Clone, Human, N-His tag HG16213-NH
SLC25A6 cDNA ORF Clone, Human, C-HA tag HG16213-CY
SLC25A6 cDNA ORF Clone, Human, N-HA tag HG16213-NY
SLC25A6 cDNA ORF Clone, Human, C-Myc tag HG16213-CM
SLC25A6 qPCR Primer Pairs, Human HP104978
info info
添加购物车成功! 添加购物车失败!