SLC22A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG16479-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SLC22A1 Reagents
CRO Services
Product recommended

All SLC22A1 Reagents
SLC22A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1665 bp
Description
Full length Clone DNA of Human solute carrier family 22 (organic cation transporter), member 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLC22A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
42278 cDNA ORF Clone, Human;HOCT1 cDNA ORF Clone, Human;oct1_cds cDNA ORF Clone, Human
SLC22A1 Background Information
Full Name
solute carrier family 22 (organic cation transporter), member 1

SLC22A1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLC22A1 cDNA ORF Clone in Cloning Vector, Mouse MG53946-U
SLC22A1 cDNA ORF Clone, Mouse, untagged MG53946-UT
SLC22A1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53946-ACGLN
SLC22A1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53946-ACG
SLC22A1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53946-ACR
SLC22A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53946-CF
SLC22A1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53946-NF
SLC22A1 cDNA ORF Clone, Mouse, C-His tag MG53946-CH
SLC22A1 cDNA ORF Clone, Mouse, N-His tag MG53946-NH
SLC22A1 cDNA ORF Clone, Mouse, C-HA tag MG53946-CY
SLC22A1 cDNA ORF Clone, Mouse, N-HA tag MG53946-NY
SLC22A1 cDNA ORF Clone, Mouse, C-Myc tag MG53946-CM
SLC22A1 cDNA ORF Clone, Mouse, N-Myc tag MG53946-NM

SLC22A1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SLC22A1 cDNA ORF Clone in Cloning Vector, Human HG16479-G
SLC22A1 cDNA ORF Clone, Human, untagged HG16479-UT
SLC22A1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16479-ACG
SLC22A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16479-ACGLN
SLC22A1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16479-ACR
SLC22A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16479-CF
SLC22A1 cDNA ORF Clone, Human, C-His tag HG16479-CH
SLC22A1 cDNA ORF Clone, Human, N-His tag HG16479-NH
SLC22A1 cDNA ORF Clone, Human, C-HA tag HG16479-CY
SLC22A1 cDNA ORF Clone, Human, N-HA tag HG16479-NY
SLC22A1 cDNA ORF Clone, Human, C-Myc tag HG16479-CM
SLC22A1 cDNA ORF Clone, Human, N-Myc tag HG16479-NM
info info
添加购物车成功! 添加购物车失败!