SKP1 cDNA ORF Clone, Human, N-HA tag

Cat: HG14161-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SKP1 Reagents
CRO Services
Product recommended

All SKP1 Reagents
SKP1 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
534 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human S-phase kinase-associated protein 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Restriction Sites
KpnI + XbaI(6kb+0.53kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
SKP1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SKP1 cDNA ORF Clone, Human, N-HA tag Validated Images
Cynomolgus LOC101926731 Gene Plasmid Map 5628
SKP1 cDNA ORF Clone, Human, N-HA tag Alternative Names
EMC19 cDNA ORF Clone, Human;OCP-II cDNA ORF Clone, Human;OCP2 cDNA ORF Clone, Human;p19A cDNA ORF Clone, Human;SKP1A cDNA ORF Clone, Human;TCEB1L cDNA ORF Clone, Human
SKP1 Background Information
Full Name
S-phase kinase-associated protein 1

SKP1 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
SKP1 cDNA ORF Clone in Cloning Vector, Canine DG70165-U

SKP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SKP1 cDNA ORF Clone in Cloning Vector, Rat RG80920-U
SKP1 cDNA ORF Clone, Rat, untagged RG80920-UT
SKP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80920-ACGLN
SKP1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80920-ACG
SKP1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80920-ANG
SKP1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80920-ACR
SKP1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80920-ANR
SKP1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80920-CF
SKP1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80920-NF
SKP1 cDNA ORF Clone, Rat, C-His tag RG80920-CH
SKP1 cDNA ORF Clone, Rat, N-His tag RG80920-NH
SKP1 cDNA ORF Clone, Rat, C-HA tag RG80920-CY
SKP1 cDNA ORF Clone, Rat, N-HA tag RG80920-NY
SKP1 cDNA ORF Clone, Rat, C-Myc tag RG80920-CM
SKP1 cDNA ORF Clone, Rat, N-Myc tag RG80920-NM
SKP1 qPCR Primer Pairs, Rat RP300884

SKP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SKP1 cDNA ORF Clone in Cloning Vector, Mouse MG51262-U
SKP1 cDNA ORF Clone, Mouse, untagged MG51262-UT
SKP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51262-ACG
SKP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51262-ACGLN
SKP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51262-ANG
SKP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51262-ACR
SKP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51262-ANR
SKP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51262-CF
SKP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51262-NF
SKP1 cDNA ORF Clone, Mouse, C-His tag MG51262-CH
SKP1 cDNA ORF Clone, Mouse, N-His tag MG51262-NH
SKP1 cDNA ORF Clone, Mouse, C-HA tag MG51262-CY
SKP1 cDNA ORF Clone, Mouse, N-HA tag MG51262-NY
SKP1 cDNA ORF Clone, Mouse, C-Myc tag MG51262-CM
SKP1 cDNA ORF Clone, Mouse, N-Myc tag MG51262-NM
SKP1 qPCR Primer Pairs, Mouse MP201144

SKP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SKP1 cDNA ORF Clone in Cloning Vector, Human HG14161-G
SKP1 cDNA ORF Clone, Human, untagged HG14161-UT
SKP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14161-ACGLN
SKP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14161-ACG
SKP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14161-ANG
SKP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14161-ACR
SKP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14161-ANR
SKP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14161-CF
SKP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14161-NF
SKP1 cDNA ORF Clone, Human, C-His tag HG14161-CH
SKP1 cDNA ORF Clone, Human, N-His tag HG14161-NH
SKP1 cDNA ORF Clone, Human, C-HA tag HG14161-CY
SKP1 cDNA ORF Clone, Human, C-Myc tag HG14161-CM
SKP1 cDNA ORF Clone, Human, N-Myc tag HG14161-NM
SKP1 qPCR Primer Pairs, Human HP102812
info info
添加购物车成功! 添加购物车失败!