Text Size:AAA

Human SIRT6 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

  • Human SIRT6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-tagged
  • Human SIRT6 natural ORF mammalian expression plasmid, C-GFPSpark tag
DatasheetReviewsRelated ProductsProtocols
Human SIRT6 cDNA Clone Product Information
NCBI RefSeq:BC005026
RefSeq ORF Size:1068bp
cDNA Description:Full length Clone DNA of Homo sapiens sirtuin 6 with C terminal GFPSpark tag.
Gene Synonym:SIR2L6, SIRT6
Species:Human
Vector:pCMV3-C-GFPSpark
Plasmid:pCMV3-SIRT6-GFPSpark
Restriction Site:KpnI + XbaI (6kb + 1.8kb)
Tag Sequence:GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with SIRT6 qPCR primers for gene expression analysis, HP101791 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human SIRT6 Gene Plasmid Map
Human SIRT6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-tagged
Human SIRT6 Gene Expression validated Image
Human SIRT6 natural ORF mammalian expression plasmid, C-GFPSpark tag
[Click to enlarge image]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.
GFPSpark Tag Info

GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.

Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"