SIRT3 cDNA ORF Clone, Human, N-His tag

Cat: HG13033-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SIRT3 Reagents
CRO Services
Product recommended

All SIRT3 Reagents
SIRT3 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1245 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human sirtuin (silent mating type information regulation 2 homolog) 3 (S. cerevisiae), transcript variant 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Restriction Sites
KpnI + XbaI(6kb+1.25kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
SIRT3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SIRT3 cDNA ORF Clone, Human, N-His tag Validated Images
Ferret TNF-alpha/TNFA/TNFSF2 Gene Plasmid Map 5629
SIRT3 cDNA ORF Clone, Human, N-His tag Alternative Names
SIR2L3 cDNA ORF Clone, Human
SIRT3 Background Information
Full Name
sirtuin 3

SIRT3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SIRT3 cDNA ORF Clone in Cloning Vector, Mouse MG50478-M
SIRT3 cDNA ORF Clone, Mouse, untagged MG50478-UT
SIRT3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50478-ACGLN
SIRT3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50478-ACG
SIRT3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50478-ANG
SIRT3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50478-ACR
SIRT3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50478-ANR
SIRT3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50478-CF
SIRT3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50478-NF
SIRT3 cDNA ORF Clone, Mouse, C-His tag MG50478-CH
SIRT3 cDNA ORF Clone, Mouse, N-His tag MG50478-NH
SIRT3 cDNA ORF Clone, Mouse, C-HA tag MG50478-CY
SIRT3 cDNA ORF Clone, Mouse, N-HA tag MG50478-NY
SIRT3 cDNA ORF Clone, Mouse, C-Myc tag MG50478-CM
SIRT3 cDNA ORF Clone, Mouse, N-Myc tag MG50478-NM
SIRT3 qPCR Primer Pairs, Mouse MP200473

SIRT3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SIRT3 cDNA ORF Clone in Cloning Vector, Human HG13033-G
SIRT3 cDNA ORF Clone, Human, untagged HG13033-UT
SIRT3 cDNA ORF Clone, Human, C-GFPSpark® tag HG13033-ACG
SIRT3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13033-ACGLN
SIRT3 cDNA ORF Clone, Human, N-GFPSpark® tag HG13033-ANG
SIRT3 cDNA ORF Clone, Human, C-OFPSpark® tag HG13033-ACR
SIRT3 cDNA ORF Clone, Human, N-OFPSpark® tag HG13033-ANR
SIRT3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13033-CF
SIRT3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13033-NF
SIRT3 cDNA ORF Clone, Human, C-His tag HG13033-CH
SIRT3 cDNA ORF Clone, Human, C-HA tag HG13033-CY
SIRT3 cDNA ORF Clone, Human, N-HA tag HG13033-NY
SIRT3 cDNA ORF Clone, Human, C-Myc tag HG13033-CM
SIRT3 cDNA ORF Clone, Human, N-Myc tag HG13033-NM
SIRT3 qPCR Primer Pairs, Human HP101672
info info
添加购物车成功! 添加购物车失败!