SIRP gamma cDNA ORF Clone, Human, N-His tag

Cat: HG16111-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SIRP gamma Reagents
CRO Services
Product recommended

All SIRP gamma Reagents
SIRP gamma cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1164 bp
Description
Full length Clone DNA of Human signal-regulatory protein gamma with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SIRP gamma cDNA ORF Clone, Human, N-His tag Alternative Names
bA77C3.1 cDNA ORF Clone, Human;CD172g cDNA ORF Clone, Human;SIRP-B2 cDNA ORF Clone, Human;SIRPB2 cDNA ORF Clone, Human;SIRPgamma cDNA ORF Clone, Human
SIRP gamma Background Information

Signal-regulatory protein gamma (SIRPG/SIRP gamma) also known as CD172 antigen-like family member B, CD172g, and CD172g antigen, is a member of the signal-regulatory protein (SIRP) family, and also belongs to the immunoglobulin superfamily. SIRP family members are receptor-type transmembrane glycoproteins known to be involved in the negative regulation of receptor tyrosine kinase-coupled signaling processes. SIRPG/SIRP gamma/CD172g is probable immunoglobulin-like cell surface receptor. On binding with CD47, SIRPG can mediate cell-cell adhesion. SIRPG/SIRP gamma is engagement on T-cells by CD47 on antigen-presenting cells results in enhanced antigen-specific T-cell proliferation and costimulates T-cell activation. SIRPG/SIRP gamma/CD172g is detected in liver, and at very low levels in brain, heart, lung, pancreas, kidney, placenta and skeletal muscle. Expressed on CD4+ T-cells, CD8+ T-cells, CD56-bright natural killer (NK) cells, CD20+ cells, and all activated NK cells. This cytokine is mainly present in the paracortical T-cell area of lymph nodes, with only sparse positive cells in the mantle and in the germinal center of B-cell follicles. In the thymus, SIRPG is primarily expressed in the medulla on mature T-lymphocytes that have undergone thymic selection.

Full Name
signal-regulatory protein gamma
References
  • Meador JA, et al. (2011) p53-independent downregulation of histone gene expression in human cell lines by high- and low-let radiation. Radiat Res. 175(6): 689-99.
  • Reddy MV, et al. (2011) Association between type 1 diabetes and GWAS SNPs in the southeast US Caucasian population. Genes Immun. 12(3): 208-12.
  • Kawasaki M, et al. (2009) Changes in the gene expression of peripheral blood mononuclear cells during the menstrual cycle of females is associated with a gender bias in the incidence of systemic lupus erythematosus. Clin Exp Rheumatol. 27(2): 260-6.
  • SIRP gamma cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    SIRP gamma cDNA ORF Clone in Cloning Vector, Rhesus CG90226-G
    SIRP gamma cDNA ORF Clone, Rhesus, untagged CG90226-UT
    SIRP gamma cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90226-ACG
    SIRP gamma Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90226-ACGLN
    SIRP gamma cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90226-ACR
    SIRP gamma cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90226-CF
    SIRP gamma cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90226-NF
    SIRP gamma cDNA ORF Clone, Rhesus, C-His tag CG90226-CH
    SIRP gamma cDNA ORF Clone, Rhesus, N-His tag CG90226-NH
    SIRP gamma cDNA ORF Clone, Rhesus, C-HA tag CG90226-CY
    SIRP gamma cDNA ORF Clone, Rhesus, N-HA tag CG90226-NY
    SIRP gamma cDNA ORF Clone, Rhesus, C-Myc tag CG90226-CM
    SIRP gamma cDNA ORF Clone, Rhesus, N-Myc tag CG90226-NM

    SIRP gamma cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SIRP gamma cDNA ORF Clone in Cloning Vector, Human HG16111-G
    SIRP gamma cDNA ORF Clone, Human, untagged HG11828-UT
    SIRP gamma cDNA ORF Clone, Human, untagged HG16111-UT
    SIRP gamma Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16111-ACGLN
    SIRP gamma Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11828-ACGLN
    SIRP gamma cDNA ORF Clone, Human, C-GFPSpark® tag HG16111-ACG
    SIRP gamma cDNA ORF Clone, Human, C-OFPSpark® tag HG16111-ACR
    SIRP gamma cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16111-CF
    SIRP gamma cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16111-NF
    SIRP gamma cDNA ORF Clone, Human, C-His tag HG16111-CH
    SIRP gamma cDNA ORF Clone, Human, C-HA tag HG16111-CY
    SIRP gamma cDNA ORF Clone, Human, N-HA tag HG16111-NY
    SIRP gamma cDNA ORF Clone, Human, C-Myc tag HG16111-CM
    SIRP gamma cDNA ORF Clone, Human, N-Myc tag HG16111-NM
    SIRP gamma qPCR Primer Pairs, Human HP104604
    info info
    添加购物车成功! 添加购物车失败!