SIGMAR1 cDNA ORF Clone, Human, C-Myc tag

Cat: HG13698-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SIGMAR1 Reagents
CRO Services
Product recommended

All SIGMAR1 Reagents
SIGMAR1 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
672 bp
Description
Full length Clone DNA of Human sigma non-opioid intracellular receptor 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SIGMAR1 cDNA ORF Clone, Human, C-Myc tag Alternative Names
ALS16 cDNA ORF Clone, Human;hSigmaR1 cDNA ORF Clone, Human;OPRS1 cDNA ORF Clone, Human;SIG-1R cDNA ORF Clone, Human;sigma1R cDNA ORF Clone, Human;SR-BP cDNA ORF Clone, Human;SR-BP1 cDNA ORF Clone, Human;SRBP cDNA ORF Clone, Human
SIGMAR1 Background Information
Full Name
sigma non-opioid intracellular receptor 1

SIGMAR1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SIGMAR1 cDNA ORF Clone in Cloning Vector, Rat RG81359-G

SIGMAR1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SIGMAR1 cDNA ORF Clone in Cloning Vector, Mouse MG57873-U
SIGMAR1 cDNA ORF Clone, Mouse, untagged MG57873-UT
SIGMAR1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57873-ACGLN
SIGMAR1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57873-ACG
SIGMAR1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57873-ACR
SIGMAR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57873-CF
SIGMAR1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57873-NF
SIGMAR1 cDNA ORF Clone, Mouse, C-His tag MG57873-CH
SIGMAR1 cDNA ORF Clone, Mouse, N-His tag MG57873-NH
SIGMAR1 cDNA ORF Clone, Mouse, C-HA tag MG57873-CY
SIGMAR1 cDNA ORF Clone, Mouse, N-HA tag MG57873-NY
SIGMAR1 cDNA ORF Clone, Mouse, C-Myc tag MG57873-CM
SIGMAR1 cDNA ORF Clone, Mouse, N-Myc tag MG57873-NM

SIGMAR1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SIGMAR1 cDNA ORF Clone in Cloning Vector, Human HG13698-G
SIGMAR1 cDNA ORF Clone, Human, untagged HG13698-UT
SIGMAR1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13698-ACGLN
SIGMAR1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13698-ACG
SIGMAR1 cDNA ORF Clone, Human, N-GFPSpark® tag HG13698-ANG
SIGMAR1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13698-ACR
SIGMAR1 cDNA ORF Clone, Human, N-OFPSpark® tag HG13698-ANR
SIGMAR1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13698-CF
SIGMAR1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13698-NF
SIGMAR1 cDNA ORF Clone, Human, C-His tag HG13698-CH
SIGMAR1 cDNA ORF Clone, Human, N-His tag HG13698-NH
SIGMAR1 cDNA ORF Clone, Human, C-HA tag HG13698-CY
SIGMAR1 cDNA ORF Clone, Human, N-HA tag HG13698-NY
SIGMAR1 cDNA ORF Clone, Human, N-Myc tag HG13698-NM
SIGMAR1 qPCR Primer Pairs, Human HP102377
info info
添加购物车成功! 添加购物车失败!