SIGLEC10 cDNA ORF Clone, Human, N-His tag

Cat: HG13765-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SIGLEC10 Reagents
CRO Services
Product recommended

All SIGLEC10 Reagents
SIGLEC10 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1809 bp
Description
Full length Clone DNA of Human sialic acid binding Ig-like lectin 10, transcript variant 3 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SIGLEC10 cDNA ORF Clone, Human, N-His tag Alternative Names
PRO940 cDNA ORF Clone, Human;SIGLEC-10 cDNA ORF Clone, Human;SLG2 cDNA ORF Clone, Human
SIGLEC10 Background Information
Full Name
sialic acid binding Ig like lectin 10

SIGLEC10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SIGLEC10 cDNA ORF Clone in Cloning Vector, Human HG13934-G
SIGLEC10 cDNA ORF Clone in Cloning Vector, Human HG13765-G
SIGLEC10 cDNA ORF Clone, Human, untagged HG29666-UT
SIGLEC10 cDNA ORF Clone, Human, untagged HG13765-UT
SIGLEC10 cDNA ORF Clone, Human, untagged HG13934-UT
SIGLEC10 cDNA ORF Clone, Human, C-GFPSpark® tag HG13934-ACG
SIGLEC10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG29666-ACGLN
SIGLEC10 cDNA ORF Clone, Human, C-GFPSpark® tag HG13765-ACG
SIGLEC10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13765-ACGLN
SIGLEC10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13934-ACGLN
SIGLEC10 cDNA ORF Clone, Human, C-OFPSpark® tag HG13934-ACR
SIGLEC10 cDNA ORF Clone, Human, C-OFPSpark® tag HG13765-ACR
SIGLEC10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13934-CF
SIGLEC10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13765-CF
SIGLEC10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13934-NF
SIGLEC10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13765-NF
SIGLEC10 cDNA ORF Clone, Human, C-His tag HG13934-CH
SIGLEC10 cDNA ORF Clone, Human, C-His tag HG13765-CH
SIGLEC10 cDNA ORF Clone, Human, N-His tag HG13934-NH
SIGLEC10 cDNA ORF Clone, Human, C-HA tag HG13934-CY
SIGLEC10 cDNA ORF Clone, Human, C-HA tag HG13765-CY
SIGLEC10 cDNA ORF Clone, Human, N-HA tag HG13934-NY
SIGLEC10 cDNA ORF Clone, Human, N-HA tag HG13765-NY
SIGLEC10 cDNA ORF Clone, Human, C-Myc tag HG13934-CM
SIGLEC10 cDNA ORF Clone, Human, C-Myc tag HG13765-CM
SIGLEC10 cDNA ORF Clone, Human, N-Myc tag HG13765-NM
SIGLEC10 cDNA ORF Clone, Human, N-Myc tag HG13934-NM
SIGLEC10 qPCR Primer Pairs, Human HP102440
info info
添加购物车成功! 添加购物车失败!