SHMT1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG13525-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SHMT1 Reagents
CRO Services
Product recommended

All SHMT1 Reagents
SHMT1 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1335 bp
Description
Full length Clone DNA of Human serine hydroxymethyltransferase 1 (soluble) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SHMT1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
CSHMT cDNA ORF Clone, Human;SHMT cDNA ORF Clone, Human
SHMT1 Background Information
Full Name
serine hydroxymethyltransferase 1 (soluble)

SHMT1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SHMT1 cDNA ORF Clone in Cloning Vector, Rat RG81449-G

SHMT1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SHMT1 cDNA ORF Clone in Cloning Vector, Mouse MG58884-U
SHMT1 cDNA ORF Clone, Mouse, untagged MG58884-UT
SHMT1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58884-ACGLN
SHMT1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58884-ACG
SHMT1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58884-ANG
SHMT1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58884-ACR
SHMT1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58884-ANR
SHMT1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58884-CF
SHMT1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58884-NF
SHMT1 cDNA ORF Clone, Mouse, C-His tag MG58884-CH
SHMT1 cDNA ORF Clone, Mouse, N-His tag MG58884-NH
SHMT1 cDNA ORF Clone, Mouse, C-HA tag MG58884-CY
SHMT1 cDNA ORF Clone, Mouse, N-HA tag MG58884-NY
SHMT1 cDNA ORF Clone, Mouse, C-Myc tag MG58884-CM
SHMT1 cDNA ORF Clone, Mouse, N-Myc tag MG58884-NM

SHMT1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SHMT1 cDNA ORF Clone in Cloning Vector, Human HG13525-G
SHMT1 cDNA ORF Clone, Human, untagged HG13525-UT
SHMT1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13525-ACG
SHMT1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13525-ACGLN
SHMT1 cDNA ORF Clone, Human, N-GFPSpark® tag HG13525-ANG
SHMT1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13525-ACR
SHMT1 cDNA ORF Clone, Human, N-OFPSpark® tag HG13525-ANR
SHMT1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13525-CF
SHMT1 cDNA ORF Clone, Human, C-His tag HG13525-CH
SHMT1 cDNA ORF Clone, Human, N-His tag HG13525-NH
SHMT1 cDNA ORF Clone, Human, C-HA tag HG13525-CY
SHMT1 cDNA ORF Clone, Human, N-HA tag HG13525-NY
SHMT1 cDNA ORF Clone, Human, C-Myc tag HG13525-CM
SHMT1 cDNA ORF Clone, Human, N-Myc tag HG13525-NM
SHMT1 qPCR Primer Pairs, Human HP102211
info info
添加购物车成功! 添加购物车失败!