Sonic Hedgehog cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10372-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Sonic Hedgehog Reagents
CRO Services
Product recommended

All Sonic Hedgehog Reagents
Sonic Hedgehog cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1389 bp
Description
Full length Clone DNA of Human sonic hedgehog homolog (Drosophila) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Sonic Hedgehog cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
HHG1 cDNA ORF Clone, Human;HLP3 cDNA ORF Clone, Human;HPE3 cDNA ORF Clone, Human;MCOPCB5 cDNA ORF Clone, Human;SMMCI cDNA ORF Clone, Human;Sonic hedgehog cDNA ORF Clone, Human;TPT cDNA ORF Clone, Human;TPTPS cDNA ORF Clone, Human
Sonic Hedgehog Background Information

Sonic HedgeHog, also known as sonic hedgehog protein, belongs to the hedgehog family. It cannot be detected in adult tissues while can be found in fetal intestine, liver, lung, and kidney. Sonic HedgeHog is a protein that is vital in guding the early embryo. It has been associated as the major inductive signal in patterning of the ventral neural tube, the anterior-posterior limb axis, and the ventral somites. Sonic HedgeHog intercellular signal is essential for a various patterning events during development: signal produced by the notochord that induces ventral cell fate in the neural tube and somites, and the polarizing signal for patterning of the anterior-posterior axis of the developing limb bud. Sonic HedgeHog binds to the patched receptor, which functions in association with smoothened, to activate the transcription of target genes. In the absence of sonic HedgeHog, patched receptor represses the constitutive signaling activity of smoothened. Sonic HedgeHog also regulates another factor, the gli oncogene. Defects in sonic hedgehog can cause microphthalmia isolated with coloboma type 5, triphalangeal thumb-polysyndactyly syndrome and holoprosencephaly type 3.

Full Name
sonic hedgehog
References
  • Ericson J, et al. (1997) Graded sonic hedgehog signaling and the specification of cell fate in the ventral neural tube. Cold Spring Harb Symp Quant Biol. 62:451-66.
  • Marigo V, et al. (1996) Regulation of patched by sonic hedgehog in the developing neural tube. Proc Natl Acad Sci. 93(18):9346-51.
  • Stone DM, et al. (1996) he tumour-suppressor gene patched encodes a candidate receptor for Sonic hedgehog. Nature. 384:129-34.
  • Sonic Hedgehog cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Sonic Hedgehog cDNA ORF Clone in Cloning Vector, Mouse MG51100-G
    Sonic Hedgehog cDNA ORF Clone, Mouse, untagged MG51100-UT
    Sonic Hedgehog Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51100-ACGLN
    Sonic Hedgehog cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51100-ACG
    Sonic Hedgehog cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51100-ACR
    Sonic Hedgehog cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51100-CF
    Sonic Hedgehog cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51100-NF
    Sonic Hedgehog cDNA ORF Clone, Mouse, C-His tag MG51100-CH
    Sonic Hedgehog cDNA ORF Clone, Mouse, N-His tag MG51100-NH
    Sonic Hedgehog cDNA ORF Clone, Mouse, C-HA tag MG51100-CY
    Sonic Hedgehog cDNA ORF Clone, Mouse, N-HA tag MG51100-NY
    Sonic Hedgehog cDNA ORF Clone, Mouse, C-Myc tag MG51100-CM
    Sonic Hedgehog cDNA ORF Clone, Mouse, N-Myc tag MG51100-NM
    Sonic Hedgehog qPCR Primer Pairs, Mouse MP201053

    Sonic Hedgehog cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Sonic Hedgehog cDNA ORF Clone in Cloning Vector, Human HG10372-M
    Sonic Hedgehog cDNA ORF Clone, Human, untagged HG10372-UT
    Sonic Hedgehog Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10372-ACGLN
    Sonic Hedgehog cDNA ORF Clone, Human, C-GFPSpark® tag HG10372-ACG
    Sonic Hedgehog cDNA ORF Clone, Human, C-OFPSpark® tag HG10372-ACR
    Sonic Hedgehog cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10372-NF
    Sonic Hedgehog cDNA ORF Clone, Human, C-His tag HG10372-CH
    Sonic Hedgehog cDNA ORF Clone, Human, N-His tag HG10372-NH
    Sonic Hedgehog cDNA ORF Clone, Human, C-HA tag HG10372-CY
    Sonic Hedgehog cDNA ORF Clone, Human, N-HA tag HG10372-NY
    Sonic Hedgehog cDNA ORF Clone, Human, C-Myc tag HG10372-CM
    Sonic Hedgehog cDNA ORF Clone, Human, N-Myc tag HG10372-NM
    Sonic Hedgehog qPCR Primer Pairs, Human HP100407
    info info
    添加购物车成功! 添加购物车失败!