SHC1/SHCA cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10036-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SHC1/SHCA Reagents
CRO Services
Product recommended

All SHC1/SHCA Reagents
SHC1/SHCA cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1425 bp
Description
Full length Clone DNA of Human SHC (Src homology 2 domain containing) transforming protein 1 (SHC1), transcript variant 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SHC1/SHCA cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
SHC cDNA ORF Clone, Human;SHCA cDNA ORF Clone, Human
SHC1/SHCA Background Information
Full Name
SHC (Src homology 2 domain containing) transforming protein 1

SHC1/SHCA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SHC1/SHCA cDNA ORF Clone in Cloning Vector, Mouse MG53647-U
SHC1/SHCA cDNA ORF Clone, Mouse, untagged MG53647-UT
SHC1/SHCA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53647-ACGLN
SHC1/SHCA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53647-ACG
SHC1/SHCA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53647-ANG
SHC1/SHCA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53647-ACR
SHC1/SHCA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53647-ANR
SHC1/SHCA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53647-CF
SHC1/SHCA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53647-NF
SHC1/SHCA cDNA ORF Clone, Mouse, C-His tag MG53647-CH
SHC1/SHCA cDNA ORF Clone, Mouse, N-His tag MG53647-NH
SHC1/SHCA cDNA ORF Clone, Mouse, C-HA tag MG53647-CY
SHC1/SHCA cDNA ORF Clone, Mouse, N-HA tag MG53647-NY
SHC1/SHCA cDNA ORF Clone, Mouse, C-Myc tag MG53647-CM
SHC1/SHCA cDNA ORF Clone, Mouse, N-Myc tag MG53647-NM

SHC1/SHCA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SHC1/SHCA cDNA ORF Clone in Cloning Vector, Human HG10036-M
SHC1/SHCA cDNA ORF Clone, Human, untagged HG29673-UT
SHC1/SHCA cDNA ORF Clone, Human, untagged HG10036-UT
SHC1/SHCA cDNA ORF Clone, Human, C-GFPSpark® tag HG10036-ACG
SHC1/SHCA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG29673-ACGLN
SHC1/SHCA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10036-ACGLN
SHC1/SHCA cDNA ORF Clone, Human, N-GFPSpark® tag HG10036-ANG
SHC1/SHCA cDNA ORF Clone, Human, C-OFPSpark® tag HG10036-ACR
SHC1/SHCA cDNA ORF Clone, Human, N-OFPSpark® tag HG10036-ANR
SHC1/SHCA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10036-CF
SHC1/SHCA cDNA ORF Clone, Human, C-His tag HG10036-CH
SHC1/SHCA cDNA ORF Clone, Human, N-His tag HG10036-NH
SHC1/SHCA cDNA ORF Clone, Human, C-HA tag HG10036-CY
SHC1/SHCA cDNA ORF Clone, Human, N-HA tag HG10036-NY
SHC1/SHCA cDNA ORF Clone, Human, C-Myc tag HG10036-CM
SHC1/SHCA cDNA ORF Clone, Human, N-Myc tag HG10036-NM
SHC1/SHCA qPCR Primer Pairs, Human HP100130
info info
添加购物车成功! 添加购物车失败!