After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human SHC1 cDNA Clone Product Information
NCBI RefSeq:NM_003029.3
RefSeq ORF Size:1425bp
cDNA Description:Full length Clone DNA of Homo sapiens SHC (Src homology 2 domain containing) transforming protein 1 (SHC1), transcript variant 2 with N terminal Flag tag.
Gene Synonym:SHC1, SHC, p66, SHCA, p52SHC, P66shc
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag tag on other vectors
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10036-ACG$225
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10036-ACR$225
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10036-ANG$225
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10036-ANR$225
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10036-CF$195
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His tagHG10036-CH$195
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10036-CM$195
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA tagHG10036-CY$195
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone in cloning vectorHG10036-M$75
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10036-M-F$195
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10036-NF$195
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His tagHG10036-NH$195
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10036-NM$195
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA tagHG10036-NY$195
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmidHG10036-UT$195
 Learn more about expression Vectors
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"