SH2D3C cDNA ORF Clone, Human, N-His tag

Cat: HG15514-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SH2D3C Reagents
CRO Services
Product recommended

All SH2D3C Reagents
SH2D3C cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2583 bp
Description
Full length Clone DNA of Human SH2 domain containing 3C with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SH2D3C cDNA ORF Clone, Human, N-His tag Alternative Names
CHAT cDNA ORF Clone, Human;NSP3 cDNA ORF Clone, Human;PRO34088 cDNA ORF Clone, Human;SHEP1 cDNA ORF Clone, Human
SH2D3C Background Information
Full Name
SH2 domain containing 3C

SH2D3C cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SH2D3C cDNA ORF Clone in Cloning Vector, Rat RG8A0853-U
SH2D3C Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0853-ACGLN

SH2D3C cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SH2D3C cDNA ORF Clone in Cloning Vector, Mouse MG53273-U
SH2D3C cDNA ORF Clone, Mouse, untagged MG53273-UT
SH2D3C cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53273-ACG
SH2D3C Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53273-ACGLN
SH2D3C cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53273-ANG
SH2D3C cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53273-ACR
SH2D3C cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53273-ANR
SH2D3C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53273-CF
SH2D3C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53273-NF
SH2D3C cDNA ORF Clone, Mouse, C-His tag MG53273-CH
SH2D3C cDNA ORF Clone, Mouse, N-His tag MG53273-NH
SH2D3C cDNA ORF Clone, Mouse, C-HA tag MG53273-CY
SH2D3C cDNA ORF Clone, Mouse, N-HA tag MG53273-NY
SH2D3C cDNA ORF Clone, Mouse, C-Myc tag MG53273-CM
SH2D3C cDNA ORF Clone, Mouse, N-Myc tag MG53273-NM

SH2D3C cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SH2D3C cDNA ORF Clone in Cloning Vector, Human HG15514-G
SH2D3C cDNA ORF Clone, Human, untagged HG15514-UT
SH2D3C cDNA ORF Clone, Human, C-GFPSpark® tag HG15514-ACG
SH2D3C Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15514-ACGLN
SH2D3C cDNA ORF Clone, Human, N-GFPSpark® tag HG15514-ANG
SH2D3C cDNA ORF Clone, Human, C-OFPSpark® tag HG15514-ACR
SH2D3C cDNA ORF Clone, Human, N-OFPSpark® tag HG15514-ANR
SH2D3C cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15514-CF
SH2D3C cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15514-NF
SH2D3C cDNA ORF Clone, Human, C-His tag HG15514-CH
SH2D3C cDNA ORF Clone, Human, C-HA tag HG15514-CY
SH2D3C cDNA ORF Clone, Human, N-HA tag HG15514-NY
SH2D3C cDNA ORF Clone, Human, C-Myc tag HG15514-CM
SH2D3C cDNA ORF Clone, Human, N-Myc tag HG15514-NM
SH2D3C qPCR Primer Pairs, Human HP104136
info info
添加购物车成功! 添加购物车失败!