After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SH2D1A Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human SH2D1A cDNA Clone Product Information
NCBI RefSeq:NM_002351.3
RefSeq ORF Size:387bp
cDNA Description:Full length Clone DNA of Homo sapiens SH2 domain protein 1A with C terminal His tag.
Gene Synonym:LYP, SAP, XLP, DSHP, EBVS, IMD5, XLPD, MTCP1, FLJ18687, FLJ92177, SH2D1A
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

SH2 domain-containing protein 1A (SH2D1A / SAP) is a 128 amino acid protein, containing a single Src homology 2 (SH2) domain, flanked by 5 amino acids at the N-terminus and 25 amino acids at the C-terminus. The absence of a catalytic domain and the presence of an SH2 domain suggest that SH2D1A regulates one or more signal transduction pathways. SH2D1A interacts with signaling lymphocytic activation molecule (SLAM), which is a transmembrane protein expressed on the surface of activated T and B cells. SH2D1A (SAP) interacts via its SH2 domain with a motif (TIYXXV) present in the cytoplasmic tail of the cell-surface receptors, including CD150 / SLAM, CD84, CD229 / Ly-9, and CD244 / 2B4. SH2D1A was expressed in EBV-carrying, tumor phenotype representative (type I), but not in EBV-carrying lymphoblastoid cell line (LCL)-like (type III) or EBV-negative Burkitt lymphoma (BL) lines. It has been supposed to be related to the X-linked lymphoproliferative disease which is also known as Duncan's disease or Purtilo syndrome. 

References
  • Morra M, et al. (2005) Defective B cell responses in the absence of SH2D1A. PNAS. 102 (13): 4819-23.
  • Morra M, et al. (2001) Characterization of SH2D1A Missense Mutations Identified in X-linked Lymphoproliferative Disease Patients. The Journal of Biological Chemistry. 276: 36809-16.
  • Hron JD, et al. (2004) SH2D1A Regulates T-dependent Humoral Autoimmunity. JEM. 200 (2): 261-6.
  • Size / Price
    Catalog: HG11149-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"