SGTA cDNA ORF Clone, Human, C-HA tag

Cat: HG14710-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SGTA Reagents
CRO Services
Product recommended

All SGTA Reagents
SGTA cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
942 bp
Description
Full length Clone DNA of Human small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SGTA cDNA ORF Clone, Human, C-HA tag Alternative Names
alphaSGT cDNA ORF Clone, Human;hSGT cDNA ORF Clone, Human;SGT cDNA ORF Clone, Human
SGTA Background Information
Full Name
small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha

SGTA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SGTA cDNA ORF Clone in Cloning Vector, Rat RG81252-U
SGTA cDNA ORF Clone, Rat, untagged RG81252-UT
SGTA cDNA ORF Clone, Rat, C-GFPSpark® tag RG81252-ACG
SGTA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81252-ACGLN
SGTA cDNA ORF Clone, Rat, N-GFPSpark® tag RG81252-ANG
SGTA cDNA ORF Clone, Rat, C-OFPSpark® tag RG81252-ACR
SGTA cDNA ORF Clone, Rat, N-OFPSpark® tag RG81252-ANR
SGTA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81252-CF
SGTA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81252-NF
SGTA cDNA ORF Clone, Rat, C-His tag RG81252-CH
SGTA cDNA ORF Clone, Rat, N-His tag RG81252-NH
SGTA cDNA ORF Clone, Rat, C-HA tag RG81252-CY
SGTA cDNA ORF Clone, Rat, N-HA tag RG81252-NY
SGTA cDNA ORF Clone, Rat, C-Myc tag RG81252-CM
SGTA cDNA ORF Clone, Rat, N-Myc tag RG81252-NM
SGTA qPCR Primer Pairs, Rat RP301208

SGTA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SGTA cDNA ORF Clone in Cloning Vector, Mouse MG52696-G
SGTA cDNA ORF Clone, Mouse, untagged MG52696-UT
SGTA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52696-ACG
SGTA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52696-ACGLN
SGTA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52696-ANG
SGTA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52696-ACR
SGTA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52696-ANR
SGTA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52696-CF
SGTA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52696-NF
SGTA cDNA ORF Clone, Mouse, C-His tag MG52696-CH
SGTA cDNA ORF Clone, Mouse, N-His tag MG52696-NH
SGTA cDNA ORF Clone, Mouse, C-HA tag MG52696-CY
SGTA cDNA ORF Clone, Mouse, N-HA tag MG52696-NY
SGTA cDNA ORF Clone, Mouse, C-Myc tag MG52696-CM
SGTA cDNA ORF Clone, Mouse, N-Myc tag MG52696-NM
SGTA qPCR Primer Pairs, Mouse MP202567

SGTA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SGTA cDNA ORF Clone in Cloning Vector, Human HG14710-G
SGTA cDNA ORF Clone, Human, untagged HG14710-UT
SGTA cDNA ORF Clone, Human, C-GFPSpark® tag HG14710-ACG
SGTA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14710-ACGLN
SGTA cDNA ORF Clone, Human, N-GFPSpark® tag HG14710-ANG
SGTA cDNA ORF Clone, Human, C-OFPSpark® tag HG14710-ACR
SGTA cDNA ORF Clone, Human, N-OFPSpark® tag HG14710-ANR
SGTA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14710-CF
SGTA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14710-NF
SGTA cDNA ORF Clone, Human, C-His tag HG14710-CH
SGTA cDNA ORF Clone, Human, N-His tag HG14710-NH
SGTA cDNA ORF Clone, Human, N-HA tag HG14710-NY
SGTA cDNA ORF Clone, Human, C-Myc tag HG14710-CM
SGTA cDNA ORF Clone, Human, N-Myc tag HG14710-NM
SGTA qPCR Primer Pairs, Human HP103344
info info
添加购物车成功! 添加购物车失败!